Zebrafish were anesthetized in 0.16 mg/mL tricaine in 1X ERM and side mounted on 1% agarose-lined Petri dishes in a minimal volume of liquid. EBD (1% w/v) was dissolved in a 0.9% saline solution. Injection needles were pulled from glass capillary tubes containing a filament on a Sutter Flaming/Brown Micropipette Puller. EBD solution was loaded into injection needles and injected into the circulation of anesthetized ~72 hpf zebrafish using a MPPI-3 pressure injector from ASI. EBD injected zebrafish were maintained in 1X ERM for 6 h before live imaging.
Flaming brown micropipette puller
Manufactured by Sutter Instruments
Sourced in United Kingdom, United States
The Flaming/Brown micropipette puller is a specialized instrument used for creating micropipettes from glass or quartz capillary tubes. It utilizes a controlled heat source and precise pulling mechanism to draw and shape the capillary material into fine, tapered tips suitable for various micromanipulation and sample handling applications.
Automatically generated - may contain errors
Lab products found in correlation
Multiclamp 700b amplifier, by Molecular Devices (4 mentions)
Glass capillary rod, by Harvard Apparatus (4 mentions)
Clampfit 10, by Molecular Devices (3 mentions)
Submerged recording chamber, by Warner Instruments (3 mentions)
1200s vibratome, by Leica (2 mentions)
Infrared differential interference contrast video enhanced microscopy, by Olympus (2 mentions)
Omnisolv lc ms grade, by Merck Group (2 mentions)
Pclamp 10, by Molecular Devices (2 mentions)
Labview, by National Instruments (2 mentions)
Pci 6289, by National Instruments (2 mentions)
Fg solution, by Biotium (1 mentions)
Slide a lyzer 10k mwco, by Thermo Fisher Scientific (1 mentions)
Morpholino antisense oligonucleotide, by Gene Tools (1 mentions)
Pulled glass micropipette, by Harvard Apparatus (1 mentions)
Rnase free dnase 1, by Thermo Fisher Scientific (1 mentions)
Qiashredder, by Qiagen (1 mentions)
Qscript cdna supermix kit, by Quanta Biosciences (1 mentions)
Genejet rna purification kit, by Thermo Fisher Scientific (1 mentions)
Alexa fluor 594, by Thermo Fisher Scientific (1 mentions)
Digidata 1322a, by Molecular Devices (1 mentions)
28 protocols using flaming brown micropipette puller
1
Zebrafish Vascular Permeability Assay
2
Slice Preparation and Electrophysiology of BNST
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Brains were sectioned at 0.07 (mm/s) on a Leica 1200S vibratome to obtain 300 µm coronal slices of the BNST, which were incubated in a heated holding chamber containing normal, oxygenated aCSF (in mM:124 NaCl, 4.4 KCl, 2 CaCl2, 1.2 MgSO4, 1 NaH2PO4, 10.0 glucose, and 26.0 NaHCO3) maintained at 30 ± 1°C for at least 1 hour before recording. Slices were transferred to a recording chamber (Warner Instruments) submerged in normal, oxygenated aCSF maintained at 28-30°C at a flow rate of 2 ml/min. Neurons of the BNST were visualized using infrared differential interference contrast (DIC) video-enhanced microscopy (Olympus). Borosilicate electrodes were pulled with a Flaming-Brown micropipette puller (Sutter Instruments) and had a pipette resistance between 3-6 MΩ. Signals were acquired via a Multiclamp 700B amplifier, digitized at 10 kHz and analyzed with Clampfit 10.3 software (Molecular Devices, Sunnyvale, CA, USA).
3
Optic Nerve Crush and Fluorescent Tracing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After anaesthetic induction as described above and a subcutaneous injection of buprenorphine (0.1 ml/100 g; National Veterinary Supplies) animals were secured in a head-holding frame. Intraorbital left ONC was performed in Group 1b and 2b 8–10 week old rats as described previously [31] (link). Briefly, the optic nerve was exposed and crushed using forceps 1 mm posterior to the lamina cribrosa, completely closed around the optic nerve for 5 seconds, without damaging the central retinal artery (confirmed by lack of ischemia in eyes 7–21 days after ONC). After surgery, animals were placed in warmed (30°C) recovery cages and closely monitored until the return of normal behaviour, when they were transferred to home cages. Two days before tissue harvest, all Group 1 animals were re-anaesthetised and the optic nerves re-exposed as above and 2 µl of 4% FG solution (Biotium, Hayward, CA) in sterile phosphate-buffered saline (PBS) was injected directly into the right and left nerves distal to the lamina cribrosa (proximal to the crush site in the left optic nerves in Group 1b), using a glass micropipette, produced in-house from a glass capillary rod (Harvard Apparatus, Kent, UK) using a Flaming-Brown micropipette puller (Sutter Instruments, Novato, CA). The injected FG is incorporated into axons and retrogradely transported axonally to RGC somata.
4
Intact Protein IMS-MS Analysis of Hemoglobin
5
Knockdown of Zebrafish Cell Signaling Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antisense morpholino oligonucleotides (MO) were obtained from GeneTools LLC and re-suspended in MilliQ H2O to give a stock concentration of 1 mM and injected in one‐cell stage embryos. A Flaming/Brown micropipette puller was used to create micro-injection needles from borosilicate glass capillary tubes (0.5 mm inner diameter, Sutter). The PV800 Pneumatic PicoPump, as part of the micro-injection jig, was set up to release the required amount of injection material by adjusting the air pressure and air expulsion time. For the knockdown of cd9b two MOs were designed, a translation blocker with the following sequence (cd9b MO1): 5’-tttatgaggagaaacccaagactga-3’ and a splice site blocker (cd9b i2e3) with the following sequence: 5’-aacccctgaacacagagaaacaaca-3’ , whilst the published mismatch MO was used 5’- tttccctgctgcttatacagcgatg -3’ [20 (link)]. For knockdown of cxcr4b and cxcl12a, the following sequences were used respectively, 5’-aatgatgctatcgtaaaattccat-3’ and 5’-ttgagatccatgtttgcagtgtgaa-3’ [21 (link)].
6
Intravitreal Virus Injection Protocol
7
Insect Tissue RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gut tissue from treated insects was dissected in PBS from both larvae and adults and haemolymph was extracted from adults using 1 mm borosilicate glass needles (pulled using a Flaming-Brown Micropipette Puller; Sutter Instruments Co., Novata, CA, USA). Haemolymph from 10 pooled adults, guts from three pooled adults and single whole bodies were placed directly in 100 µl of lysis buffer supplemented with 2% β-mercaptoethanol and stored at −80°C until further use. Total RNA was extracted from these tissues using QIAshredder (Qiagen) columns to homogenize tissues and a GeneJET RNA purification kit (Thermo Fisher Scientific). Contaminating genomic DNA was removed using an RNase-free DNase I (Thermo Fisher Scientific) treatment. RNA was quantified and purity was assessed using a Biochrom NanoVue UV–Vis spectrophotometer. Complementary DNA (cDNA) was synthesized with a qScript cDNA Supermix kit (Quanta Biosciences). The purity of the cDNA was verified by PCR amplification using a Lucigen EconoTaq PLUS 2X Master Mix (following the manufacturer's protocol) with actin-2-specific primers (electronic supplementary material, table S2), and subsequent 1.5% agarose gel electrophoresis.
8
Patch-Clamp Electrodes for Somatic and Dendritic Recordings
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Borosilicate capillary glass 1.65-mm external diameter (World Precision Instruments) was pulled with a Flaming/Brown micropipette puller (model P-97, Sutter Instruments). Electrodes used for somatic recordings were pulled to have a resistance of 4–6 MΩ. For dendritic recordings electrodes had a resistance of 6–9 MΩ and were wrapped with Parafilm to reduce the capacitance of the electrode. Electrodes were filled with a solution containing: 120 mM potassium gluconate, 8 mM NaCl, 16 mM KCl, and 11 mM HEPES, 4 mM Mg-ATP, 0.3 mM Na-GTP, 7 mM 2K-phosphocreatine, and 0.2% neurobiotin; pH 7.37. For dendritic recordings, 16 µM Alexa Fluor 594 (Thermo Fisher Scientific) was included to determine recording location.
9
Patch-Clamp Recording of MVN Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MVN neurons identified visually by location, size and fluorescence were recorded using borosilicate glass pipettes of external diameter 1.2 mm/internal diameter 0.69 mm (Harvard Apparatus) pulled from Flaming/Brown micropipette puller (Model P-97, Sutter Instrument) and filled with high chloride internal solution (in mM): 140 CsCl, 10 HEPES, 1 EGTA, 2 MgCl2, 2 Na2ATP, and 1 Na2GTP (adjusted to pH 7.2, 290 mOsm). The advancement of the pipette was manually operated through the micromanipulator (Sutter Instrument).
Signals were amplified using MultiClamp700A (Axon Instruments) and acquired through a 16-bit data acquisition system (DIGIDATA 1322A; Axon Instruments). During whole-cell patch-clamp recording, membrane potentials were corrected for the liquid junction potential (10 mV), and the change of series resistance was sustained within 15%. Only recordings with series resistance smaller than 15 MΩ were included for subsequent analysis. Cell recording was discarded if the leaking currents went beyond 200 pA. The signals of the recording were digitized at 10 kHz and filtered at 3 kHz by the Multiclamp 700A amplifier, DIGIDATA 1322A analog/digital interface board and pCLAMP 10.2 software (Axon Instruments). Data were captured by Clampex 10.2/Multiclamp Commander 1 (Axon Instruments) package.
Signals were amplified using MultiClamp700A (Axon Instruments) and acquired through a 16-bit data acquisition system (DIGIDATA 1322A; Axon Instruments). During whole-cell patch-clamp recording, membrane potentials were corrected for the liquid junction potential (10 mV), and the change of series resistance was sustained within 15%. Only recordings with series resistance smaller than 15 MΩ were included for subsequent analysis. Cell recording was discarded if the leaking currents went beyond 200 pA. The signals of the recording were digitized at 10 kHz and filtered at 3 kHz by the Multiclamp 700A amplifier, DIGIDATA 1322A analog/digital interface board and pCLAMP 10.2 software (Axon Instruments). Data were captured by Clampex 10.2/Multiclamp Commander 1 (Axon Instruments) package.
10
Preparation and Injection of cRNA into Xenopus Oocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A horizontal Flaming/Brown micropipette puller (P-97; Sutter Instruments, CA) was used to prepare injection capillaries with a tip resistance of 3 to 4 MΩ. Tips of capillars were then polished with Micro Forge MF-830 (Narishige, Japan) to reach a 10- to 30-μm tip diameter for cRNA injection. Capillars were then backfilled with sterile mineral oil and filled with 3 to 5 μl of cRNA solution. Forty nanograms of cRNA (41.4 to 50.6 nl) per oocyte was injected using the Nanoject II system (Drummond Scientific, CO) and incubated for 72 h at 19°C. Control oocytes were injected with same amount of diethylpyrocarbonate (DEPC) water.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!