Pen strep

Murine bone-marrow-derived mesenchymal stromal cell-line D1 (ATCC, CRL-12424TM) was cultured in expansion media composed of high-glucose Dulbecco-modified minimal essential medium (DMEM) (Life Technologies Limited Inc., Paisley, UK), 10% superior fetal bovine serum (FBS) (Sigma-Aldrich, St. Louis, MO, USA), 1% penicillin and 1% streptomycin (Pen-Strep) (Mediatech Inc., Manassas, VA, USA), 2 mM Glutamax (Life Technologies, Grand Island, NY, USA) in standard cultivation conditions (37 °C, 5% CO₂, 95% humidity). On the day of producing the 3-D constructs, the cells were harvested at 70–80% confluency. For this purpose, PBS containing Pen-Strep and trypsin (both from PAN-Biotech GmbH, Aidenbach, Germany) were used to wash and detach the cells, respectively. Before the cells were encapsulated in fibrin gels, they were passed through a 40-µm cell strainer (Life Science Inc., Durham, NC, USA) and then counted to ensure no cell aggregation.

All cell lines were acquired from DSMZ (Braunschweig, Germany). HL60 and K562 were cultured in RPMI-1640 medium (Life Technologies, Darmstadt, Germany) with 10% fetal bovine serum (FBS) (Biochrom, Berlin, Germany) and 1% PenStrep (PAN-Biotech, Aidenbach, Germany). Kasumi-1 cells were cultured with RPMI-1640 medium, 1% PenStrep and 20% FBS.
Human bone marrow CD34+ cells, containing HSPCs, were purchased from Lonza (Cologne, Germany) and cultured using IMDM (GE Healthcare Life Sciences, Pasching, Austria) complemented with 20% FBS 2% glutamine, 100 U PenStrep, 20 ng/ml FLT3-l, 20 ng/ml GM-CSF, hIL-3 10 ng/ml, hIL-6 20 ng/ml, hSCF 20 ng/ml, hTPO 20 ng/ml all from Peprotech (Hamburg, Germany).
PDX were described before [30 (link)]. Briefly, cells were isolated from NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ (NSG) mice bone marrow and then cultured in StemPro-34 SFM Medium (StemCell Technologies, Grenoble, France) supplemented with 1% PenStrep, 1% L-Glutamine, 2% FBS and 10 ng/ml SCF, TPO and IL-3.
The pMSCV-IRES-GFP ZBTB7A WT, R402C, and A175fs were described before [1 (link)]. The pMSCV-RUNX1-RUNX1T1tr-IRES-tdTomato was described before [31 (link)]. pSpCas9(BB)-2A-GFP (px458) is available from Addgene (Plasmid #48138) and gRNA sequences targeting ZBTB7A (GACTCGAGGTACTCCTTGGCG or GCCGCCGCTGCCAGCTTCCCG) were cloned as described before [32 (link)].

Prior to the experiments, A549 cells were tested for genetic characteristics using PCR single-locus technology for authentication. Twenty-one independent PCR systems: Amelogenin, D3S1358, D1S1656, D6S1043, D13S317, Penta E, D16S539, D18S51, D2S1338, CSF1PO, Penta D, TH01, vWA, D21S11, D7S820, D5S818, TPOX, D8S1179, D12S391, D19S433 and FGA, were investigated (Promega, Walldorf, Germany, PowerPlex 21 PCR Kit). In parallel, positive and negative controls were tested, yielding correct results. Cells were certified as the A549 human lung carcinoma cell line detected in the Leibniz Institute DSMZ, German Collection of Microorganisms and Cell Cultures online database (Eurofins Medigenomix Forensik GmbH, Ebersberg, Germany). The A549 cell line is parental to all three established knockout cell lines: CAR-KO-, CD46-KO- and CC-KO-A549. All four cell lines were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (PAN Biotech, Aidenbach, Germany), supplemented with 10% fetal bovine serum (FBS, GE Healthcare, Münster, Germany) and 100 µg/mL penicillin/streptomycin (Pen/Strep, PAN Biotech). Mycoplasma contamination testing was carried out by PCR using the mycoplasma detection Kit Venor^®GeM Classic (Minerva Biolabs GmbH, Berlin, Germany). All cell lines tested negative for mycoplasma using the mycoplasma detection Kit Venor^®GeM Classic (Minerva Biolabs GmbH, Germany).

Patient and control fibroblasts were cultured in Dulbecco's modified Eagle's medium (high glucose; Life Technologies, Karlsruhe, Germany) containing 10% foetal calf serum (PAN Biotech, Aidenbach, Germany) and 1% Pen/Strep at 5% CO₂ at 37°C. Growth medium was changed every 72 h. For the sugar supplementation studies, L‐fucose (100 µM in PBS) was added to the growth medium for 48 h. For viral infection of fibroblasts, the ecotropic packaging cell line FNX‐Eco (ATCC) and the amphotropic packaging cell line RetroPack PT67 (Clontech) were cultured in DMEM containing 1 × L‐glutamine, 1× Pen/Strep and 10% foetal calf serum (PAN Biotech GmbH; heat‐inactivated at 65°C for 30 min) at 37°C under 5% CO₂.

Human embryonic kidney HEK-293T cells (ATCC-CRL-3216) and human immortalized keratinocyte HaCaT cells (94 (link)) were cultured in Dulbecco’s modified Eagle medium (DMEM; Gibco). Human retinal pigment epithelial cell line ARPE-19 (ATCC-CRL-2302) was cultured in Dulbecco’s modified Eagle medium/Nutrient Mixture F-12 Ham (D/F-12; SIGMA). All media were supplemented with 8% fetal bovine serum (FBS; SIGMA), penicillin-streptomycin (Pen/Strep; PAN-Biotech), and 2 mM Glutamine Stable (Cytogen). Cercopithecus aethiops kidney epithelial Vero cells (ATCC-CCL-81) were cultured in MEM Eagle (Cytogen) with 8% FBS. Cells were grown at 37°C, with 5% CO₂ in a humidified incubator.