The Aβ1-40 peptide was obtained from Sigma-Aldrich (St. Louis, MO, USA). STF-083010, a specific IRE1α I endonuclease inhibitor, was bought from Sigma-Aldrich and was prepared fresh in a dark room with DMSO for a 25 mM stock solution. The RNA Fast Isolation kit and M-MLV Reverse Transcriptase were obtained from BioTeke Corporation (Beijing, China). The SYBR Green PCR Kit was purchased from Solarbio Science & Technology (Beijing, China), and the Caspase-2 cellular activity assay kit was purchased from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The LDH Activity Assay Kit was purchased from Abcam. The miR-34a mimic oligonucleotide and control RNA were purchased from GenePharma (Shanghai, China). The Lipofectamine™ 2000 reagent was obtained from Invitrogen Life Technologies (Carlsbad, CA, USA). Antibodies for the Western blot assay were purchased as follows: XBP1, IRE1α, and p-IRE1α antibodies (Abcam, Cambridge, UK) and Caspase-2 and β-actin antibodies (Sigma-Aldrich, St. Louis, MO, USA). All culture media and fetal bovine serum (FBS) were obtained from Gibco (Carlsbad, CA, USA). Unless specifically mentioned, all other reagents were purchased from Sigma-Aldrich.
Sybr green pcr kit
Manufactured by Solarbio
Sourced in China
The SYBR Green PCR Kit is a reagent system for real-time polymerase chain reaction (PCR) analysis. It contains all the necessary components, including SYBR Green I dye, for the detection and quantification of DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
M mlv reverse transcriptase, by BioTeke (1 mentions)
Aβ1 40 peptide, by Merck Group (1 mentions)
Stf 083010, by Merck Group (1 mentions)
Control rna, by GenePharma (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Exicyclertm 96, by Bioneer (1 mentions)
Pr6502, by BioTeke (1 mentions)
Trizol, by BioTeke (1 mentions)
Beyort 2 m mlv, by Beyotime (1 mentions)
Exicycler 96 instrument, by Bioneer (1 mentions)
Lightcycler 96 instrument, by Roche (1 mentions)
Trizol reagent, by Solarbio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Qiagen (1 mentions)
Abi prism 7500 sequence, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rt primer, by GenScript (1 mentions)
Tripure reagent, by BioTeke (1 mentions)
8 protocols using sybr green pcr kit
1
Investigating Amyloid-Beta Induced Apoptosis
2
Quantifying Gene Expression in Liver Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from the liver and using TRIpure regent (RP1001, BioTeke). The cDNA was synthesized from RNA by a reverse transcription reagent kit (PR6502, BioTeke). The expressions of these genes (shown in Table 1 ) were determined by qRT-PCR and using SYBR Green PCR kit (SY1020, Solarbio), which were performed on Real-Time PCR System (ExicyclerTM 96, BIONEER, Korea). ß-Actin was used as a reference gene and comparison in expression between groups was made using the 2−ΔΔCT method.
3
Real-time PCR Analysis of ACSL4 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cells using TRIzol (BioTeke, RP1001, Beijing, China), and the resulting RNA samples were reverse transcribed using BeyoRT II M-MLV (BeyoTime, D7160L, Shanghai, China) reverse transcriptase to produce the corresponding cDNA. Real-time PCR analysis was performed on an Exicycler 96 instrument (Bioneer Corporation, Daejeon, Korea) using a SYBR Green PCR Kit (Solarbio, SY1020, Beijing, China). The relative expression of mRNAs was normalized to β-actin. The primer sequences are shown in Table 1 . Interference sequences and negative control sequences are shown in Table 2 .
List of Genetic Primers
| Name | Sequence (5’-3’) |
|---|---|
| mus ACSL4 F | AGAAGGATCTTGGGTTGA |
| mus ACSL4 R | GCTTGAAGGCATCTGTTA |
| mus β-actin F | CTGTGCCCATCTACGAGGGCTAT |
| mus β-actin R | TTTGATGTCACGCACGATTTCC |
| homo ACSL4 F | GCATTCCTCCAAGTAGACC |
| homo ACSL4 R | ATGAGCCAAAGGCAAGT |
| homo β-actin F | GGCACCCAGCACAATGAA |
| homo β-actin R | TAGAAGCATTTGCGGTGG |
Interference and Negative Control Sequence
| Name | Sequence (5’-3’) |
|---|---|
| siNC | UUCUCCGAACGUGUCACGUTT |
| ACGUGACACGUUCGGAGAATT | |
| siACSL4-1 | GUAUGUAUCUCUUGGGAAATT |
| UUUCCCAAGAGAUACAUACTT | |
| siACSL4-2 | CGGAAAUCAUGGAUAGAAUTT |
| AUUCUAUCCAUGAUUUCCGTT | |
| siACSL4-3 | GCAAAGAAGCAGUAGUUCATT |
| UGAACUACUGCUUCUUUGCTT |
4
Quantitative PCR Analysis of c-Met Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from A549, SKOV3, HepG2, and MDA-MB-468 cells using TRIzol reagent (Solarbio, Beijing, China) and reverse-transcribed with Reverse Transcription System (Solarbio, Beijing, China). Quantitative PCR was performed on a LightCycler96 instrument (Roche) using SYBR Green PCR Kit (Solarbio, Beijing, China). The qPCR profile of the reaction was 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 30 s. The primers used were as follows: c-Met, forward (5ʹ -ACA GTG GCA TGT CAA CAT CGC T-3ʹ) and reverse (5ʹ -GCT CGG TAG TCT ACA GAT TC-3ʹ); GAPDH, forward (5ʹ -CAA TGA CCC CTT CAT TGA CC-3ʹ) and reverse (5ʹ -GAC AAG CTT CCC GTT CTC AG-3ʹ). GAPDH mRNA expression was measured as an endogenous control, and MDA-MB-468 cells were as the calibrator sample.
5
Quantification of Inflammatory Cytokines in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (#15596-026, Invitrogen) was adopted to separate total RNA from lung, liver and heart tissues. Reverse Transcription Kit (#218061, Qiagen, Valencia, CA, USA) was utilized to reverse-transcribe RNA into cDNA. Subsequently, the SYBRGreen PCR kit (SR1110, Solarbio) was applied and qPCR amplification was carried out on a Real-time PCR detector (Roche 480, Mannheim, Germany). The mRNA levels of IL-6, TNF-α and IL-1β were examined by 2−ΔΔCt method, and β-actin was served as the reference gene. The primer sequences used in the research included: IL-6-FW, 5′-TGA TGG ATG CTT CCA AAC TG-3′, IL-6-RW, 5′-GAG CAT TGG AAG TTG GGG TA-3′; TNF-α-FW, 5′-ACT GAA CTT CGG GGT GAT TG-3′, TNF-α-RW, 5′-GCT TGG TGG TTT GCT ACG AC-3′; IL-1β-FW, 5′-CAC CTT CTT TTC CTT CAT CTT TG-3′, IL-1β-RW, 5′-GTC GTT GCT TGT CTC TCC TTG TA-3′; β-actin-FW, 5′-TCC TGT GGC ATC CAC GAA ACT-3′, β-actin-RW, 5′-GAA GCA TTT GCG GTG GAC GAT-3′.
6
Quantifying Inflammatory Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol (Invitrogen Inc.) and reversely transcripted to complementary DNA using a PrimeScript RT reagent Kit (Takara). RT‐qPCR was performed with a SYBR Green PCR kit (SY1020, Solarbio) using an ABI Prism 7500 sequence detection system (Applied Biosystems). The expression of tumor necrosis factor‐α (TNF‐α), interleukin (IL)‐6, and IL‐1β in the cell supernatant was calculated by the 2−ΔΔCT method. GAPDH wasutilized as a reference gene. The primer sequences used are as follows: TNF‐α, forward 5′‐CTGGGCAGGTCTACTTTGGG‐3′ and reverse 5′‐CTGGAGGCCCCAGTTTGAAT‐3′; IL‐6, forward 5′‐GGTCCAGTTGCCTTCTCCCTG‐3′ and reverse 5′‐GCCCATGCTACATTTGCCG‐3′; IL‐1β, forward 5′‐TACCTGTCCTGCGTGTTGAA‐3′ and reverse 5′‐TCTTTGGGTAATTTTTGGGATCT‐3′; GAPDH, forward 5′‐AATGGGCAGCCGTTAGGAAA‐3′ and reverse 5′‐GCGCCCAATACGACCAAATC‐3′.
7
KI67 and GAPDH Expression in Renal Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from renal tissues and cells using total RNA isolating kit (Tiangen, Beijing, China) according to the manufacturer's introductions. The RNA samples were reversely transcribed into cDNA using an RT Primer (Genscript, Nanjing, China) and RNase inhibitor (DP418, Tiangen). RT-PCR reactions were carried out with the SYBR green PCR kit (SY1020, Solarbio) and specific primers of forward 5′CTGACCCTGATGAGAGTGAGGGA3′ and reverse 5′ACTCTGTAGGGTCGAGCAGG3′ for Ki67; forward 5′GACCTGACCTGCCGTCTAG3′ and reverse 5′AGGAGTGGGTGTCGCTGT3′ for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The relative levels of KI67 to the control GAPDH mRNA transcripts were analyzed by the 2−ΔΔCt method.
8
Quantitative Analysis of miR-363-3p and S1PR1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lung tissues were homogenized and total RNAs were isolated using TRIpure reagent (RP1201, BioTeke Corp., Beijing, China). Total RNA was reverse transcribed to cDNA using M-MLV Transcriptase (BioTeke Corp.). Subsequently, RT-PCR amplification was performed using a SYBR Green PCR Kit (Solarbio, Beijing, China). The primers used for PCR were as follows:, 5’-AATTGCACGGTATCCATCTGTA-3’ (forward) and 5’-GTGCAGGGTCCGAGGT-3’ (reverse) for miR-363-3p and 5’-CGCAAGAACATCTCCAAG-3’ (forward) and 5’-CAGCACAGCCAGAACCAG-3’ (reverse) for S1PR1. Relative mRNA expression was determined with the 2-ΔΔCT method [26 (link)] and normalized to β-actin or U6.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!