Alkaline phosphatase coupled anti digoxigenin antibody

Mouse embryos or brains were removed and rapidly rinsed in diethylpyrocarbonate -treated PBS and then fixed in 4% paraformaldehyde-PBS at RT overnight. Tissues were automatically dehydrated in ethanol using a vacuum infiltration processor (Tissue-Tek VIP 5 Jr., Sakura, Alphen aan den Rijn, Netherlands) and embedded in paraffin wax. Sections of 5 μm were prepared using a sliding microtome (SM2000R, Leica, Wetzlar, Germany), mounted on microscope slides and dried at 55 °C overnight. The staining procedure including further processing of the sections such as dewaxing and rehydration was automatically performed by using the Discovery XT System (Roche, Basel, Switzerland). Hybridization of DIG-labelled riboprobes was carried out at 65 °C for 6 h using 50 ng of DIG-labelled riboprobe per slide diluted in 100 μl hybridization buffer. Detection of DIG was performed using an alkaline phosphatase-coupled anti-digoxigenin antibody (Roche) followed by colour development with the use of NBT and BCIP (Roche). Subsequently, cell nuclei were stained with hematoxyline. Slides were mounted with water-soluble mounting medium (Aqua-Poly Mount, Polysciences, Eppelheim, Germany). In situ hybridization slides were analysed and photographed using a BX50 microscope (Olympus, Tokyo, Japan) equipped with a DP72 camera (Olympus).

Whole-mount in situ hybridization was carried out as described previously^{45 (link)}. Antisense RNA probes for alkbh3 mRNA were labeled with digoxigenin (Roche, Switzerland). Zebrafish embryos at different stages were fixed in 4% paraformaldehyde and incubated with digoxigenin-labeled RNA probes. Alkaline phosphatase-coupled anti-digoxigenin antibody (Roche, Switzerland) was used to detect hybridized probes, and 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) solution (Sigma, USA) was used as the chromogenic substrate.

Brain sections were processed for in situ hybridization with digoxigenin-UTP-labeled antisense riboprobes. Sense and antisense digoxigenin-labeled riboprobes for mouse Gad67, Nkx2.2, and vGlut2 were synthesized following the manufacture’s recommendations (Roche Diagnostics S.L., Applied Science, Barcelona, Spain), and applying specific polymerases (Fermentas, Madrid, Spain). Probe sequence information is: Nkx2.2 (NCBI accession number U31566.1, bp size 2,018, position 1–2018 J from Rubenstein’s lab); Gad67 (bp size 2,000, full coding sequence from Bryan Condi; see Long et al. 2009; their Table 1) and vGlut2 (bp size 305, 305 from 3′ end, from Robert Edwards; see Long et al. 2009; their Table 1).
In situ hybridization (ISH) was performed as described by Ferran et al. [69 ]. After hybridization, all sections were washed and incubated in a solution containing alkaline phosphatase coupled anti-digoxigenin antibody (diluted 1:3.500; Roche Diagnostics). Nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; Roche) solution was then used as chromogenic substrate for the final alkaline phosphatase reaction (Boehringer, Mannheim, Germany). No specific signal was obtained with sense probes (data not shown).

The tissues were processed for in situ hybridization with digoxigenin‐UTP‐labeled antisense riboprobes. Sense and antisense digoxigenin‐labeled riboprobes for mouse Calb1, Calb2, Enc1, Nkx2.2, and Six3 were synthesized following the manufacter's recommendations (Roche Diagnostics S.L., Applied Science, Barcelona, Spain), and applying specific polymerases (Fermentas, Madrid, Spain). Probe sequence information is provided in Table 2. In situ hybridization (ISH) was performed basically as described by Ferran, Ayad, et al. (2015). After hybridization, all sections were washed and incubated in a solution containing alkaline phosphatase‐coupled anti‐digoxigenin antibody (diluted 1:3.500; Roche Diagnostics). Nitroblue tetrazolium/5‐bromo‐4‐chloro‐3‐indolyl phosphate (NBT/BCIP; Roche) solution was then used as chromogenic substrate for the final alkaline phosphatase reaction (Boehringer, Mannheim, Germany). No specific signal was obtained with sense probes (data not shown).
Dlx1, Dlx2, Dlx5, Dlx6, Isl1, Pax6, Ecel1 and Sst expression was analyzed from in situ hybridization images downloaded from the Allen Developing Mouse Brain Atlas (https://developingmouse.brain-map.org).

In situ hybridization was performed as described^{60 (link)}. Embryos were fixed in 4% PFA, dehydrated in methanol and rehydrated stepwise in methanol/PBS then 100% PBT (1× PBS 0.1% Tween 20). Embryos were incubated in hybridization buffer for 1 h followed by hybridization at 70 °C overnight. Following washes in hybridization buffer/SSC, embryos were incubated with preabsorbed alkaline-phosphatase coupled anti-digoxigenin antibody from Roche (Sigma aldrich, SKU 11093274910), at 1:5000 final dilution overnight at 4 °C. Detection was performed using an alkaline-phosphatase substrate solution (NBT, Sigma Aldrich SKU 11383213001; BCIP, Sigma Aldrich, SKU 11383221001). Reaction was stopped by washing in PBT.
emx3 riboprobe template was generated by PCR amplification using cDNA from 24hpf embryos.
T7 promoter: TAATACGACTCACTATAGGGemx3 antisense:
FWD: TCCATCCATCCTTCCCCCTT
RVS: TAATACGACTCACTATAGGGGTGCTGACTGCCTTTCCTCT
DIG-labeled riboprobes were generated using 2ul of PCR template with the Roche DIG RNA Labeling Kit (T7) (Sigma aldrich, SKU 11277073910)
Whole-mount imaging was carried out using a Zeiss Axioscope2 microscope. Embryos were imaged in a 2.5% glycerol solution.