Hiflex buffer
The HiFlex buffer is a laboratory reagent designed to facilitate efficient DNA or RNA extraction and purification. It serves as a key component in various nucleic acid isolation protocols, providing the necessary chemical and physical conditions to optimize the extraction process. The HiFlex buffer's core function is to create an environment that enables the effective capture, separation, and purification of genetic material from a wide range of sample types.
Lab products found in correlation
12 protocols using hiflex buffer
Evaluation of Circulating EV miRNAs
Comprehensive RNA-Seq Analysis of miRNA and lncRNA
Single-cell Preparation and Transcriptional Analysis
Quantitative RT-PCR Analysis of miRNA Expression
Quantitative Analysis of mRNA and miRNA
Quantification of Adipogenic and Osteogenic Markers
PPARG (Forward, AACACTAAACCACAAATATACAACAAG; Reverse, GGCATCTCTGTGTCAACCAT)
CEBPA (CGGCAACTCTAGTATTTAGGATAAC; CAAATAAAATGACAAGGCACGATT)
RUNX2 (TTCTCCCCTTTTCCCACTGA; CAAACGCAATCACTATCTATACCAT)
BGLAP (CAGCGAGGTAGTGAAGAGACC; TCAGCCAACTCGTCACAGTC)
PPIA (ATGCTGGACCCAACACAAA; TTTCACTTTGCCAAACACCA)
Total RNA Extraction and cDNA Synthesis
Reverse Transcription and qRT-PCR of piRNAs
Quantifying Cardiac miR-21 Expression
Quantitative miRNA Expression Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!