Primestar hs

Total DNA was extracted from the AdAH cells as described previously,¹⁹ and A3H gene corresponding to a.a. pos 15, 18, 121, and 178 was amplified by the primers listed in Table S1, utilizing PrimeStar HS (Takara). The amplicons were sequenced using the primers by which they were amplified.

To prepare the original circular DNA, we first PCR-amplified DNA fragments encoding the phi29 DNA polymerase and loxP sequence using KOD FX (Toyobo, Japan), primer 1 (5′-CGGAGATCTCGTTGTAAAACGACGGCCAG-3′), primer 2 (5′-ACGAGATCTCCGGCTCGTATGTTGTGTGG-3′), and the template plasmid (pUC-phi29DNAP-loxP) constructed in a previous study^{22 (link)}. The whole sequence of the original circular DNA is shown in Fig. S6. For clone 6 and clone 6-wt-loxP, corresponding plasmids, pUC-clone6 and pUC-clone 6-loxP-wt, respectively, were used. Preparation of these plasmids were described below. Then, we digested the DNA fragments with 0.5 U/μl BglII (TaKaRa, Japan) in the reaction mixture according to the manufacturer’s instruction for 1 h at 37 °C and self-ligated them using 1.75 U/μl T4 DNA ligase (TaKaRa) to produce the original circular DNA in the reaction mixture according to the manufacturer’s instruction for 1 h at 16 °C. For the circular DNA used for the in vitro evolution experiment, the initial PCR contained 0.12 mM alpha-S 2-deoxycytidine-5′-O-1-thiotriphosphate (dCTP; TriLink Biotechnologies). A DNA fragment encoding GFP under the control of the T7 promoter was prepared by amplifying the template plasmid pET-g5tag. We used PrimeSTAR HS (TaKaRa) and the primers 5′-GCGAAATTAATACGACTCACTATAGGG-3′ and 5′-GGTTATGCTAGTTATTGCTCAGCGG-3′ for amplification.

For sequencing the coding region of CG13025 in flies with mutant mus302 alleles, each allele was crossed to the deficiency line Df(3L)ED4606 and DNA was extracted from a male as in (Adams et al. 2003 (link)). CG13025 was amplified with the high-fidelity polymerase PrimeSTAR HS (Takara) (primers: 5′-ATCTCGATCTTGACCATCCCTAGC-3′ and 5′-TCCACAACAGACTTT GAGCATTCA-3′) and sequenced by Sanger sequencing (Eton) with the two primers used for amplification plus 5′-CGAGCATCGACTGGTCTCG-3′. Sequences from the mutant alleles were compared to the presumed original wild-type alleles in flies from the corresponding screen by sequencing CG13025 from the mus312^D1 and mus312^Z1973, which were isolated in the same screens. Allele-specific PCRs were developed for the mus302^D1 (5′-CCAAGCACTCCATGCTGAA-3′ and 5′-AGAATGTAAGGGCCGTAAGT-3′) and the mus302^Z1882 (TAGAGATATCCGTCATCTGTGA and GTAGGTGGATCAATAAAGCG) to identify specific mus302 alleles in recombinant chromosomes.

DNA was amplified using a high fidelity enzyme (PrimeStar HS, Takara Bio Inc., Japan), or a standard enzyme (BIOTaq, Bioline, UK), and primers detailed in Additional file 1 Table S1. Amplicons were cloned using the CloneJET PCR Cloning Kit (Thermo Scientific) or the pGEM-T Easy Vector System (Promega). Purification of plasmids from E. coli was carried out following a boiling method [64 (link)] or using a commercial kit (Illustra plasmidPrep Mini Spin Kit, GE Healthcare). For plasmid profile gels, DNA was purified by alkaline lysis and separated by electrophoresis in 0.8% agarose gels with 1xTAE as described [25 (link)]. Plasmids were transferred to P. syringae by electroporation [65 ].
DNA sequences were compared and aligned using the BLAST algorithms [66 (link)], as well as the on-line MULTALIN [67 (link)] and EMBL-EBI server tools (http://www.ebi.ac.uk/Tools/msa/). The InterPro interface [68 (link)] (http://www.ebi.ac.uk/interpro/) was used to search for protein motifs. Nucleotide sequence visualization and manipulation was performed using the Artemis genome browser and ACT [69 (link)]. Primers were designed using the Primer3plus software [70 (link)].

Routine genetic manipulations were performed as described elsewhere [31 ]. Restriction and modification enzymes were purchased from Thermo Fisher Scientific. PrimeSTAR HS from Takara Bio Inc. was used for DNA amplification.