Log In Sign up
The largest database of trusted experimental protocols

Ywhaq trcn0000078169

Manufactured by Addgene
Visit Supplier

The YWHAQ TRCN0000078169 is a lab equipment product used for gene knockdown experiments. It targets the YWHAQ gene and is intended for use in research applications.

Automatically generated - may contain errors

Lab products found in correlation

Scramble shrna shc002, by Merck Group (2 mentions) Plko 1 puro cmv turbogfp lentivirus plasmid, by Merck Group (2 mentions) Ywhaz trcn0000029404, by Addgene (2 mentions)

2 protocols using ywhaq trcn0000078169

1

Generating LNK and shRNA Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pLKO.1-puro-CMV-TurboGFP lentivirus plasmid (SHC003) was obtained from Sigma. The entire coding region of huLNK, including the HIS tag and V5 tag, was amplified from pcDNA3 LNK using primers TGAGCTAGCATGAACGGGCCTGCCCTGCAGCC (Nhe I) and AAACACGTGCTCGAGCGGCCGCCACTGT (Pml I). The PCR product was ligated to pGEM-T vector and validated by Sanger sequencing. This construct was digested with Nhe I and Pml I, the LNK containing fragment was gel purified, and the GFP coding fragment of pLKO-CMV-GFP vector (SHC003) was replaced with the LNK open reading frame (pLKO-CMV-LNK). For gene silencing, shRNA plasmids targeted to LNK [TRCN0000265715 (shRNA15), TRCN0000265716 (shRNA16), TRCN0000256095 (shRNA95) and Scramble shRNA SHC002 were purchased from Sigma. shRNA plasmids targeted to AKT1 (TRCN0000010174), 14-3-3 Q (YWHAQ TRCN0000078169), 14-3-3 Z (YWHAZ TRCN0000029404) and 14-3-3 G (YWHAG TRCN0000078158) were generated according to the protocol described by Addgene (http://www.addgene.org/tools/protocols/plko/). The sequences of all the shRNA constructs were confirmed by Sanger sequencing using the U6 primer.
Ding L.W., Sun Q.Y., Lin D.C., Chien W., Hattori N., Dong X.M., Gery S., Garg M., Doan N.B., Said J.W., Xiao J.F., Yang H., Liu L.Z., Meng X., Huang R.Y., Tang K, & Koeffler H.P. (2014). LNK (SH2B3): paradoxical effects in ovarian cancer. Oncogene, 34(11), 1463-1474.
+ Open protocol
+ Expand
2

Generating LNK and shRNA Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pLKO.1-puro-CMV-TurboGFP lentivirus plasmid (SHC003) was obtained from Sigma. The entire coding region of huLNK, including the HIS tag and V5 tag, was amplified from pcDNA3 LNK using primers TGAGCTAGCATGAACGGGCCTGCCCTGCAGCC (Nhe I) and AAACACGTGCTCGAGCGGCCGCCACTGT (Pml I). The PCR product was ligated to pGEM-T vector and validated by Sanger sequencing. This construct was digested with Nhe I and Pml I, the LNK containing fragment was gel purified, and the GFP coding fragment of pLKO-CMV-GFP vector (SHC003) was replaced with the LNK open reading frame (pLKO-CMV-LNK). For gene silencing, shRNA plasmids targeted to LNK [TRCN0000265715 (shRNA15), TRCN0000265716 (shRNA16), TRCN0000256095 (shRNA95) and Scramble shRNA SHC002 were purchased from Sigma. shRNA plasmids targeted to AKT1 (TRCN0000010174), 14-3-3 Q (YWHAQ TRCN0000078169), 14-3-3 Z (YWHAZ TRCN0000029404) and 14-3-3 G (YWHAG TRCN0000078158) were generated according to the protocol described by Addgene (http://www.addgene.org/tools/protocols/plko/). The sequences of all the shRNA constructs were confirmed by Sanger sequencing using the U6 primer.
Ding L.W., Sun Q.Y., Lin D.C., Chien W., Hattori N., Dong X.M., Gery S., Garg M., Doan N.B., Said J.W., Xiao J.F., Yang H., Liu L.Z., Meng X., Huang R.Y., Tang K, & Koeffler H.P. (2014). LNK (SH2B3): paradoxical effects in ovarian cancer. Oncogene, 34(11), 1463-1474.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!