Pgl4.20 vector

HIF-1A 5′UTR cDNA sequence or hypoxia response element [14 (link)] of VEGF were synthesized (Genewiz Company, Suzhou, China.) and cloned to the pGL4.20 vector (Promega) at the upstream of the luciferase sequence. The pGL4.20-HIF1A-5′UTR-LUC or pGL-4.20-7 × HRE and renilla vectors were transiently transfected into ± PTBP3 OE cells using Lipofectamine 2000. At 48 h post-transfection, cells were lysed and analyzed for firefly luciferase (Fluc) activity and renilla luciferase (Rluc) using the Dual Luciferase Reporter Assay System (Promega). The Rluc activity was used for normalization.

Fragment spanning −2800 to +20, relative to the transcription start site of human Cryptic gene sequence (accession number: NC_000002.11) was PCR amplified with primers (Forward: 5′GGTACCCCCCTCACATGCAATCTCTAG3′ and Reverse: 5′CTCGAGCTCTATGAGACCT GGCTGGG3′ flanking KpnI and XhoI sites) (GenoRime, India) with reaction conditions set as: 98 °C for 5 min, 98 °C for 30 s, 64 °C for 30 s, 72 °C for 3 min, repeat cycle 2–4 × 30 times, 72 °C for 15 min, hold at 4 °C and the amplified product cloned into pGEMT Vector (Promega, USA) by TA-cloning to produce pGEMT-CrypticPro. pGEMT-CrypticPro was subsequently sub-cloned into pGL4.20 vector (Promega, USA) using KpnI and XhoI sites, to generate pGL4.20-Cryptic luciferase reporter. Further, deletion constructs were made in the similar way by changing the forward primer. Forward primer for single binding construct: 5′-GGTACCCCTCTTGATGGCAAACAGG-3′, for no snail biding site: 5′-GGTACCCGTGCTTTCCCTTATCCTCG-3′. pCDNA3-Flag-Snail is kind a gift from Dr. Weiss (University of Michigan, USA). β-gal plasmid is kind gift from Dr Mahapatra IITM. Mouse monoclonal anti human Cryptic antibody was purchased from R&D systems (MAB1410-SP) and Goat polyclonal anti Snail antibody was purchased from SantaCruz biotech (sc-10433 X).

Cells from the AD-293 cell line, a derivative of the HEK293 cell line with improved adherence and plaque formation properties, were purchased from Stratagene (La Jolla, CA, USA). The protocols were adopted and modified from our previous report.^{25 (link)} All compounds were dissolved in DMSO at 10 mM as a stock solution. The final concentration of DMSO was 0.1% in the culture medium. AD-293 cells bearing luciferase reporters with promoter regions of IL-6/STAT3 and TNF-α/NF-κB in pGL4.20 vector (Promega) were maintained in DMEM high glucose medium supplemented with 10% FBS and 1% penicillin streptomycin in the presence of 1 μg mL⁻¹ puromycin. AD-293 cells overexpressing TLR4 and stably transfected with NF-κB reporter were maintained in DMEM high glucose medium in the presence of 1 μg mL⁻¹ puromycin and 10 μg mL⁻¹ blasticidin. All cells were maintained in a humidified incubator at 37 °C in 95% air and 5% CO₂.

The RANKL promoter fragment was amplified with PCR using human genomic DNA. The purified RANKL promoter region was cloned into the pGL4.20 vector (Promega) at the XhoI and HindIII sites. The luciferase reporter plasmids were prepared by using the Geneaid mini plasmid kit (Geneaid).

The pXP2-IL-5RαP1 promoter construct containing bp −561 to +51 of the human IL-5Rα subunit P1 promoter has been previously described in detail [28 (link),49 (link)]. Constructs containing two different mutations of the functional C/EBP site were generated by PCR mutagenesis and constructs containing single and multiple GATA site mutations were generated by site-directed mutagenesis (see below).
The pGL4.20 promoter constructs were generated by introducing restriction sites through the PCR amplification of existing promoter constructs and subcloning into the pGL4.20 vector (Promega, Madison, WI, USA). Specifically, the IL-5RαP1 promoter was amplified from the pXP2-IL-5RαP1 construct and subcloned using HindIII sites. The IL-5RαP2 promoter (bp −485 to +35) was amplified from a previously described construct [29 (link)] kindly provided by Dr. Ji Zhang (Schering-Plough Research Institute, Kenilworth, NJ, USA) and subcloned using XhoI and HindIII sites. All constructs were confirmed by sequencing.