Nativepage gel system

Manufactured by Thermo Fisher Scientific

The NativePAGE Gel system is a laboratory equipment used for the separation and analysis of protein complexes in their native, non-denatured state. It is designed to preserve the structure and function of proteins during electrophoresis, allowing for the study of protein-protein interactions and the characterization of protein complexes.

Automatically generated - may contain errors

Lab products found in correlation

Ab87399, by Abcam (2 mentions) Semitransfer system, by Bio-Rad (2 mentions) Ab110244, by Abcam (2 mentions) Ecl reagent, by Thermo Fisher Scientific (2 mentions) Immobilon, by Merck Group (2 mentions) Film imaging system, by Fujifilm (2 mentions) Ab32072, by Abcam (2 mentions) Bca protein assay kit, by Thermo Fisher Scientific (2 mentions) Coomassie brilliant blue, by Solarbio (1 mentions) Nativepage sample prep kit, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

NativePAGE Novex Bis-Tris Gel System NativePAGE Bis-Tris Gel System 4%–16% NativePAGE Bis-Tris Gel System NativePAGE Novex 4-16% Bis-Tris Gel System NativePAGE gels NativePAGE system

4 protocols using nativepage gel system

Two-Dimensional Blue Native PAGE Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blue Native (BN)/PAGE was performed using the Invitrogen NativePAGE Gel system with minor modifications. In brief, mitochondria from pooled retina were enriched and used for BN-PAGE gel as described^{27 (link)}. Electrophoresis was performed according to the manufacturer’s specifications (Invitrogen). BN-PAGE strips were equilibrated and applied to the 2D SDS gel as described by Invitrogen. Samples were separated in the second dimension and transferred to PVDF membranes (Immobilon; Millipore, Burlington, MA) using the semitransfer system (Bio-Rad, Hercules, CA). The following antibodies were used: anti-Myc [Y69] (ab32072, abcam, 1:500), anti-NDUFS4 [2C7CD4AG3] (ab87399, abcam, 1:1000) and anti-NDUFB6 [21C11BC11] (ab 110244, abcam, 1:1000). Secondary probing with anti-mouse (32230, ThermoFisher, 1:5000) or anti-rabbit HRP-conjugated antibodies (32260, ThermoFisher, 1:5000) was performed for 1 h, followed by detection using ECL reagents (ThermoFisher) and a FUJI Film Imaging system.

Liu Y., Eastwood J.D., Alba D.E., Velmurugan S., Sun N., Porciatti V., Lee R.K., Hauswirth W.W., Guy J, & Yu H. (2022). Gene therapy restores mitochondrial function and protects retinal ganglion cells in optic neuropathy induced by a mito-targeted mutant ND1 gene. Gene therapy, 29(6), 368-378.

+ Open protocol

+ Expand

Two-Dimensional Blue Native PAGE Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Recombinant Expression and Purification of EmuDdi1

Check if the same lab product or an alternative is used in the 5 most similar protocols

To express the recombinant EmuDdi1 protein, a pair of specific primers containing Sal I and Xho I restriction sites (EmuDdi1-F: CGAGCTCATGAGGCTTTCTTT CGTTC and EmuDdi1-R: CCCTCGAGACTAGGGGAG A CTGCTCATG) were designed and synthesized. The EmuDdi1 coding sequence was amplified and cloned into the expression vector pET-28a (+). Expression was induced by 1mM IPTG at 28°C. The recombinant EmuDdi1 protein was purified by affinity chromatography on a HiTrapTM column (GE), and then dialyzed against PBS at 4°C for 12 h. The purified protein was analyzed on 12.5% SDS-polyacrylamide gels and stained with Coomassie Brilliant Blue (Solarbio, China). Non-denaturing PAGE (NativePAGE™ Gel system, ThermoFisher) was used to analyze the dimer of the recombinant EmuDdi1. The concentration of recombinant EmuDdi1 protein was determined with the BCA protein assay kit (ThermoFisher) and was stored at −80°C until used.

Liu Z., Guo X., Guo A., Zhang S., Zou Y., Wang Y., Li X., He W., Pu L., Zhang S., Zeng Q., Cai X, & Wang S. (2022). HIV protease inhibitor nelfinavir is a potent drug candidate against echinococcosis by targeting Ddi1-like protein. eBioMedicine, 82, 104177.

+ Open protocol

+ Expand

Native Gel Electrophoresis of BAT Mitochondria

Check if the same lab product or an alternative is used in the 5 most similar protocols

Frozen pellets of 200 μg BAT mitochondria were lysed in 100 μL of NativePAGE sample buffer, supplemented with 1× HALT protease and phosphatase inhibitor cocktail and 1% n-dodecyl-β-D-maltoside (DDM), using a NativePAGE Sample Prep kit (Thermo Fisher). Aliquots of 20 μg lysed mitochondria were supplemented with Coomassie G-250 to final concentration of 0.25%, then run out on native 4–16% bis–tris gels using the Native PAGE gel system (Thermo Fisher). Gels were treated with Fix Solution (40% methanol, 10% acetic acid), microwaved for 45 s, and destained with 8% acetic acid for up to 5 h before imaging.

Palmer C.J., Bruckner R.J., Paulo J.A., Kazak L., Long J.Z., Mina A.I., Deng Z., LeClair K.B., Hall J.A., Hong S., Zushin P.J., Smith K.L., Gygi S.P., Hagen S., Cohen D.E, & Banks A.S. (2017). Cdkal1, a type 2 diabetes susceptibility gene, regulates mitochondrial function in adipose tissue. Molecular Metabolism, 6(10), 1212-1225.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!