Total RNA from OVCAR-3 and Caov-3 cells was extracted with Total RNA Isolating kit (BioTeke Corporation) following the manufacturer's protocols. Complementary DNA was obtained by RT using M-MLV reverse transcriptase kit (Takara Biotechnology Co., Ltd.) and RT Primer (GenScript) according to the manufacturer's protocol. The relative expression level of miR-638 was determined by qPCR amplification using TaKaRa Taq™ HS Perfect Mix (Takara Biotechnology Co., Ltd.) with SYBR Green (BioTeke Corporation). The thermocycling conditions consisted of: Pre-denaturation at 94˚C for 30 sec, followed by 40 cycles at 94˚C for 5 sec and 60˚C for 15 sec. miR-638 expression was normalized against the expression of U6. The relative expression level of miR-638 was converted to fold changes according to the 2-ΔΔCq method (24 (link)). The primers used were as follows: miR-638 forward, 5'-AATAGGGATCGCGGGCGG-3' and reverse, 5'-GCAGGGTCCGAGGTATTC-3', and U6 forward, 5'-GCTTCGGCAGCACATATACT-3' and reverse, 5'-GTGCAGGGTCCGAGGTATTC-3'.
Rt primer
Manufactured by GenScript
Sourced in China
RT Primer is a laboratory equipment product used for reverse transcription, a fundamental step in the process of converting RNA into cDNA. It provides the necessary primer sequences to initiate the reverse transcription reaction, allowing for the synthesis of complementary DNA from RNA templates.
Automatically generated - may contain errors
2 protocols using rt primer
1
Quantification of miR-638 Expression
2
KI67 and GAPDH Expression in Renal Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from renal tissues and cells using total RNA isolating kit (Tiangen, Beijing, China) according to the manufacturer's introductions. The RNA samples were reversely transcribed into cDNA using an RT Primer (Genscript, Nanjing, China) and RNase inhibitor (DP418, Tiangen). RT-PCR reactions were carried out with the SYBR green PCR kit (SY1020, Solarbio) and specific primers of forward 5′CTGACCCTGATGAGAGTGAGGGA3′ and reverse 5′ACTCTGTAGGGTCGAGCAGG3′ for Ki67; forward 5′GACCTGACCTGCCGTCTAG3′ and reverse 5′AGGAGTGGGTGTCGCTGT3′ for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The relative levels of KI67 to the control GAPDH mRNA transcripts were analyzed by the 2−ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!