Sodium chloride (nacl)

Sodium hypochlorite (NaClO, 14%), sodium hydrogen phosphate (NaH₂PO₄), sodium chloride (NaCl), calcium chloride dihydrate (CaCl₂∙2H₂O), magnesium sulfate heptahydrate (MgSO₄∙7H₂O), sodium hydrogen carbonate (NaHCO₃), potassium nitrate (KNO₃), sodium nitrate (NaNO₃), calcium carbonate (CaCO₃), magnesium chloride hexahydrate (MgCl₂∙6H₂O), potassium sulfate (K₂SO₄), sodium sulfate (Na₂SO₄), calcium sulfate dihydrate (CaSO₄∙2H₂O), boric acid (H₃BO₃, 0.5%), hydrogen peroxide (H₂O₂, 30%), and chloride acid (HCl, 0.1 M) were purchased from Scharlab S.L., Barcelona, Spain. The ultrapure water (Milli-Q) used in the experiments was obtained from Millipore, Molsheim, France, equipment (conductivity less than 0.055 µS cm⁻¹).
Polyvinyl chloride (PVC, Mw 112,000 g mol⁻¹) was supplied by ATOCHEM, Madrid, Spain. Tetrahydrofuran (THF) was purchased from Scharlab S.L. Amberlite^® IRA-402 (Cl⁻ form, total exchange capacity ≥ 1.0 mol L⁻¹) was supplied by Merck Life Science, Darmstadt, Germany, S.L.U.

Amoxicillin trihydrate was bought from TCI (Tokyo, Japan) and Eudragit^® L100 was acquired from Evonik Industries (Essen, Germany). Dibutyl sebacate, isopropanol and potassium phosphate monobasic for the HPLC mobile phase were purchased from Sigma Aldrich (St. Louis, MO, USA). Methanol was bought from VWR International (Radnor, PA, USA).
The negative epoxy based photoresist SU-8 was used for production of microcontainers. Formulations with two different viscosities were used (i.e., SU-8 2035 and 2075) and the cross-linked structures were developed in Developer mr-Dev 600. Resist and developer were purchased from Micro Resist Technology GmbH (Berlin, Germany). Single-side polished ø100 mm Si substrates with a thickness of 525 µm were acquired from Topsil Globalwafers A/S (Frederikssund, Denmark).
For the phosphate buffered saline (PBS) used in the in situ perfusion studies, sodium chloride, potassium chloride, sodium phosphate dibasic and potassium phosphate monobasic were purchased from Scharlab (Barcelona, Spain). Animals were from Charles River Laboratories (Quebec, QC, Canada). Sylgaard 184 silicone elastomer kit was purchased from Dow Chemical (Midland, MI, USA). Ultrapure water used throughout the studies was obtained from a Q-POD^® dispenser (Merck Millipore, Burlington, MA, USA).

Concerning the transducer, the MoS₂ powder of high purity (99%) used as the precursor for the growth of 2D flakes was obtained from Alfa Aesar. Sodium phosphate and sodium chloride were obtained from Scharlab Co. Synthetic 22-mer oligonucleotides were supplied by Sigma-Aldrich Co. A single-stranded DNA sequence modified at 5′-end with an hexalquilthiol was used as capture probe, and denoted as ss-DNAp-SH. As target analyte a fully complementary sequence (denoted as miRNA21c) and the non-complementary sequence (denoted as miRNA21nc) were used. All these sequences are listed in Table 1. All solutions were prepared just prior to use. Water was purified with a Millipore Milli-Q-system (18.2 MΩ·cm) and was sterilized with a Nüve OT 012 small steam autoclave.Table 1

Synthetic oligonucleotides used in this work.

Nomenclature	Oligonucleotides sequence
ss-DNAp-SH	5′-SH(CH2)6–TCAACATCAGTCTGATAAGCTA
miRNA21c	5′-UAGCUUAUCAGACUGAUGUUGA
miRNA21nc	5′-AUCGAAUAGUCUGACUACAACU

All reagents were analytical-reagent grade unless otherwise stated. Potassium nitrate (99%) and sodium chloride (99.5%) were obtained from Scharlau (Barcelona, Spain). Kerosene and ammonia (30%) were obtained from Panreac (Barcelona, Spain). Sodium thiosulfate (100%) was purchased from Merck (Darmstadt, Germany). Tri-isobutylphosphine sulfide (TIBPS) was provided by Cytec Industries Inc (Saddle Brook, NJ, USA), and humic acids were obtained from Aldrich (Steinheim, Germany). Aqueous solutions of silver were prepared from a 1000 mg L⁻¹ standard solution obtained from Merck (Darmstadt, Germany). Deionized water of resistivity lower than 18.2 MΩ cm was obtained by a Millipore Quantum Ultrapure water supplier (Millipore, Bedford, Ma, USA). Acetylene for atomic spectrometry was obtained from Air Liquide (Madrid, Spain).

The tri-reactive dye Cibacron Yellow S-3R (CY) was selected for this study. Three reactive dyes were selected for the study of water reuse: Procion Yellow H-EXL (PY), Procion Crimson H-EXL (PC), and Procion Navy H-EXL (PN). All dyes were provided by DyStar (L’Hospitalet de Llobregat, Spain). Figure 1 shows the chemical structures corresponding to PY, PC, and PN. The formula corresponding to CY has not yet been published.
Industrial effluents were simulated using sodium carbonate obtained from Sigma-Aldrich (Madrid, Spain) and sodium chloride purchased from Scharlau (Sentmenat, Spain). To test the effect of pH on the nanofiltration process, NaOH and HCl supplied by Scharlau (Sentmenat, Spain) were used.
The detergent COTEMOLL TLTR supplied by Color Center (Terrassa, Spain) was used in the washing step of the dyeing process.
Sodium hypochlorite solution (6%–14% active chlorine) acquired from Sigma-Aldrich (Madrid, Spain) was used for the membrane cleaning.

From our collection of clinical Acinetobacter spp., we selected and tested 22 kanamycin susceptible clinical isolates collected between 1992 and 2008. The isolates originated from five different geographical and/or distinct Portuguese hospitals (Table 1) and had different resistant profiles. The naturally competent A. baumannii A118 clinical strain was included as a positive control for transformability [10 (link)].
Bacteria were grown in Luria-Bertani (LB) (Fluka, Saint Louis, MO, USA) agar (Liofilchem, Roseto d. Abruzzi, Italy) medium and incubated at 37 °C. The ability of the various isolates to undergo natural transformation was examined during growth on plates containing 0.5% agar (Liofilchem), 5 g/L tryptone (Difco, Sparks, MD, USA) and 2.5 g/L sodium chloride (Scharlau, Sentmenat, Spain) [13 (link)], here called Motility Medium (MM).
Transformant cells were selected on LB plates supplemented with 30 µg/mL of kanamycin (Sigma, Saint Louis, MO, USA).
The competent isolates detected in this study were identified to the species level by sequencing of the rpoB gene [18 (link)] (sequencing provider STAB VIDA, Portugal).

L-tryptophan (98%), decanoyl chloride (98%), sodium hydroxide (97%), sodium bicarbonate (97%), 3-aminopropyl trimethoxysilane (97%), tetraethyl orthosilicate (98%), butyric acid (99%), cetyltrimethylammonium bromide (99%), and dichloromethane (99.8%) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Tetrahydrofuran (TFH, 99.5%), hydrochloric acid (35% w/w), oleic acid (99%), palmitic acid (99%), citric acid (99%), ammonia solution (32% w/w), iron (III) chloride (97%), iron (II) chloride tetrahydrate (99%), and sodium chloride (99.5%) were supplied by Scharlab (Barcelona, Spain).