Dp304 02

Venous blood (3–4 ml) was collected from the base of tail of the cattle in EDTA tubes, shaken well, transferred to 5-ml freezing tubes, and placed in a liquid nitrogen tank for storage. The whole-blood genome was extracted using a DNA extraction kit (Tiangen, DP304-02), and the DNA quality was detected with 0.75% agarose gel electrophoresis; DNA concentration and purity were detected using a spectrophotometer, and the DNA samples were stored at −20 °C.

For the genetic sexing of embryos, a small piece of tissue was digested to extract DNA with a genomic DNA extraction kit (TIANGEN, DP304-02). Genetic sexing was carried out by a standard genotyping PCR protocol focused on the chicken CHD1 (Chromo-helicase-DNA-Binding) gene. The CHD1 primer is listed in Supplementary Table S1. These primers are targeting the introns of the CHD1 gene, which is located on the Z (CHD1Z, 482 bp) and W chromosomes (CHD1W, 326 bp) (58 ). PCR reactions were 95°C for 5 min followed by 30 cycles of 95°C for 30 s, 51°C for 30 s, 72°C for 30 s, and a final extension step of 72°C for 10 min. Amplicons were separated from one band (Z) in the case of male animals or two bands (Z + W) in the case of female animals on a 1% agarose gel.

Telomerase content was evaluated using an enzyme‐linked immunosorbent assay kit for human telomerase (HM11275; Bio‐Swamp) following the manufacturer's instructions. For the detection of telomere length, DNA was first extracted using a reagent kit (DP304‐02; Tiangen, Hangzhou, China). The DNA was mixed with primers for telomeres (270 nm for TEL1; 900 nm for TEL2) and the single‐copy gene 36B4 (300 nm for 36B4u; 500 nm for 36B4d) as a reference, at a total volume of 5 μL, and qRT‐PCR was performed. The primers were TEL1, 5′‐GGTTTTTGA[GGGTGA]₄GGGT‐3′; TEL2, 5′‐TCCCGACTAT[CCCTAT]₄CCCTA‐3′; 36B4u, 5′‐CAGCAAGTGGGAAGGTGTAATCC‐3′; and 36B4d, 5′‐CCCATTCTATCATCAACGGGTACAA‐3′. Telomere amplification was performed at 50 °C for 2 min and 30 cycles of 95 °C for 15 s and 54 °C for 2 s. Single‐copy gene amplification was performed at 50 °C for 2 min, 95 °C for 2 min, and 35 cycles of 95 °C for 15 s and 58 °C for 60 s. Data acquisition was carried out using the QuantStudio™ 6 Flex Real‐Time PCR System (Applied Biosystems) and analyzed with the 2‐ΔΔCt method.