Puc57 sgrna expression vector

The oligos for mutation and correctional sgRNA were synthesized, cloned into the pGL3-U6-sgRNA-PGK-puromycin (51133; Addgene) and pUC57-sgRNA expression vector (51132; Addgene), and in vitro transcribed as the reported protocol:¹⁷ (link) mutation sgRNA, 5′-CGCCAATGGTGTTAACACATAGG-3′; correctional sgRNA, 5′-CCGCCAATGGTGTTAACACgTAG-3′. Besides, the correctional sgRNA was also cloned into the pGL3-U6-sgRNA-PGK-GFP plasmid for the comparison of BE3, YE1-BE3, and YEE-BE3. The plasmids of Cas9 (44758; Addgene), BE3 (73021; Addgene), YE1-BE3 (85174; Addgene), and YEE-BE3 (85177; Addgene) were used, and these plasmids were transcribed in vitro as the reported protocol.¹⁷ (link) All of the transcribed RNA were stored at −80°C. The ssODN was synthesized at Sangon Biotech (http://www.sangon.com/) as the following sequence: 5′-GACGTATGGTGTTGGGTAAATCCGGGAGGACATTTGCATGTGAAGCCGCCAATGGTGTTAACACgTAGGAACTGGCAGTTGTGTTGCTTGGTTGCACACTCATCAAGATC-3′.

To elucidate the giraffe-type FGFRL1 gene’s role in skeletogenesis and the cardiovascular system, the seven unique substitutions in giraffe-type FGFRL1 were introduced into the FGFRL1 gene in mice (giraffe-type FGFRL1 mice) by CRISPR-Cas9–mediated genome editing as follows. First, single-guide RNA (sgRNA) expression constructs were prepared, based on the pUC57-sgRNA expression vector (no. 51132; Addgene), using oligonucleotide sequences listed in table S21. Next, the sgRNA expression plasmids were linearized and prepared as templates for in vitro transcription using a MEGAshortscript kit (Ambion, AM1354). The sgRNA was purified using a MEGAclear kit (Ambion, AM1908). Fertilized eggs were injected with a mixture of Cas9 protein, sgRNAs, and homologous DNA template. Genomic DNA was then extracted from the tails of 7-day-old mice (“new pups”) using phenol-chloroform and recovered by alcohol precipitation to detect the mutations. Polymerase chain reaction primers for targeting sites are listed in table S22. Last, mice with expected mutations were mated with WT mice to get enough heterozygous mutant mice, and then homozygous mutant mice were produced by crossing and prepared for consequence experiments.

Plasmids used include pUC57-sgRNA expression vector (Addgene, 51132), pGL3-U6-sgRNA-EGFP (Addgene, 107721), and pCMV-hA3A-BE3-Y130F (Addgene, 113428), available from Addgene.

LentiCRISPR-v2 plasmid was a gift from Dr. Feng Zhang of Broad Institute of MIT and Harvard. LentiCRISPRv2-p11-gRNA was constructed as described previously 45 (link), 46 (link). Briefly, P11-gRNAs were designed according to CRISPR Design Tool (http://crispr.mit.edu/) and synthesized with BsmBI sticky end, then annealed and inserted into the BsmBI (Fermentas, Vilnius, Lithuania) digested lentiCRISPR-v2 plasmid. For constructing lentiviral vector MSCV- P11, the P11 coding sequence was amplified using wild-type MEF cDNA as the template, and then digested with XhoI and EcoRI (Fermentas), and cloned into MSCV PIG(18751, Addgene, Cambridge, USA). Primer sequences are described below (restriction enzyme recognition sites shown underlined):
F(5'-3'): AATCTCGAGATGCCATCCCAAATGGAGCAC; R(5'-3'): AATGAATTCCTACTTCTTCCCCTTCTGCT.
Cas9 expression vector (pST1374-N-NLS-flag-linkerCas9) for in vitro transcription (44758) and PUC57-sgRNA expression vector (51132) were obtained from Addgene. P11-gRNAs were designed according to CRISPR Design Tool (http://crispr.mit.edu/). Synthesized oligos for gRNA expression were denatured at 95 °C for 5 minutes and annealed at room temperature, then cloned into linearized PUC57-sgRNA expression vector.