Log In Sign up
The largest database of trusted experimental protocols

Quantstudio 7 flex real time pcr system

Manufactured by Integrated DNA Technologies
Visit Supplier
Sourced in United States

The QuantStudio™ 7 Flex Real-Time PCR System is a laboratory instrument designed for quantitative real-time PCR analysis. It is capable of detecting and quantifying targeted DNA sequences in samples.

Automatically generated - may contain errors

Lab products found in correlation

2019 ncov cdc ruo kit, by Integrated DNA Technologies (8 mentions) Taqpath 1 step rt qpcr master mix, by Thermo Fisher Scientific (5 mentions) Qiashredder homogenizer, by Qiagen (1 mentions) Kingfisher flex platform, by Thermo Fisher Scientific (1 mentions)

8 protocols using quantstudio 7 flex real time pcr system

1

SARS-CoV-2 RT-qPCR Viral Load Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from nasal washes and throat swabs. Samples were inactivated in AVL (Qiagen, Hilden, Germany) and ethanol. Downstream extraction was then performed using the BioSprint™ 96 One-For-All vet kit (Indical) and Kingfisher Flex platform, as per the manufacturer’s instructions. Tissue homogenate was centrifuged through a QIAshredder homogenizer (Qiagen) and supplemented with ethanol as per the manufacturer’s instructions. Downstream extraction from tissue samples was then performed using the BioSprint™ 96 One-For-All vet kit (Indical) and Kingfisher Flex platform, as per the manufacturer’s instructions. Reverse-transcription quantitative polymerase chain reaction (RT-qPCR) targeting a region of the SARS-CoV-2 nucleocapsid (N) gene was used to determine viral loads, and was performed using TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™), the 2019-nCoV CDC RUO Kit (Integrated DNA Technologies, Coralville, IA, USA), and a QuantStudio™ 7 Flex Real-Time PCR System. Undetected samples were assigned the value of <2.3 copies/μL, equivalent to the assay’s lower limit of detection (LLOD).
Compagnone M., Pinto E., Salvatori E., Lione L., Conforti A., Marchese S., Ravà M., Ryan K., Hall Y., Rayner E., Salguero F.J., Paterson J., Iannacone M., De Francesco R., Aurisicchio L, & Palombo F. (2022). DNA-Vaccine-Induced Immune Response Correlates with Lower Viral SARS-CoV-2 Titers in a Ferret Model. Vaccines, 10(8), 1178.
+ Open protocol
+ Expand
2

SARS-CoV-2 Viral Load Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Samples from pharyngeal swabs and lung homogenates were RNA extracted using the BioSprint one-for-all vet kit (Indical, UK) and Kingfisher Flex platform (ThermoFisher, UK). Reverse transcription-quantitative polymerase chain rection of the nucleocapsid (N) gene was used to determine viral loads and was performed using TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies) and QuantStudio™ 7 Flex Real-Time PCR System. Sequences of the N1 primers and probe were: 2019-nCoV_N1-forward, 5′ GACCCCAAAATCAGCGAAAT 3’; 2019-nCoV_N1-reverse, 5′ TCTGGTTACTGCCAGTTGAATCTG 3’; 2019-nCoV_N1-probe, 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3’, targeting a region of the SARS-CoV-2 nucleocapsid. The cycling conditions were: 25 °C for 2 min, 50 °C for 15 min, 95 °C for 2 min, followed by 45 cycles of 95 °C for 3 s, 55 °C for 30 s. The quantification standard was in vitro transcribed RNA of the SARS-CoV-2 N ORF (accession number NC_045512.2) with quantification between 1 × 10e1 and 1 × 10e6 copies/μl.
Findlay-Wilson S., Easterbrook L., Smith S., Pope N., Humphries G., Schuhmann H., Ngabo D., Rayner E., Otter A.D., Coleman T., Hicks B., Graham V.A., Halkerston R., Apostolakis K., Taylor S., Fotheringham S., Horton A., Tree J.A., Wand M., Hewson R, & Dowall S.D. (2022). Development of a cost-effective ovine antibody-based therapy against SARS-CoV-2 infection and contribution of antibodies specific to the spike subunit proteins. Antiviral Research, 203, 105332.
+ Open protocol
+ Expand
3

SARS-CoV-2 Quantification by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from the nasal wash, throat swabs, and BAL. Samples were inactivated in AVL (Qiagen) and ethanol. Downstream extraction was then performed using the BioSprint™96 One-For-All vet kit (Indical) and Kingfisher Flex platform as per the manufacturer’s instructions. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) targeting a region of the SARS-CoV-2 nucleocapsid (N) gene was used to determine viral loads and was performed using TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies) and QuantStudio™ 7 Flex Real-Time PCR System. Sequences of the N1 primers and probe were: 2019-nCoV_N1-forward, 5′ GACCCCAAAATCAGCGAAAT 3′; 2019-nCoV_N1-reverse, 5′ TCTGGTTACTGCCAGTTGAATCTG 3′; 2019-nCoV_N1-probe, 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′. The cycling conditions were: 25 °C for 2 m, 50 °C for 15 m, 95 °C for 2 m, followed by 45 cycles of 95 °C for 3 s, 55 °C for 30 s. The quantification standard was in vitro transcribed RNA of the SARS-CoV-2 N ORF (accession number NC_045512.2) with quantification between 1 × 101 and 1 × 106 copies/µl. Positive samples detected below the LOQ were assigned the value of 5 copies/µl, whilst undetected samples were assigned the value of < 2.3 copies/µl, equivalent to the assay’s lower limit of detection.
Lambe T., Spencer A.J., Thomas K.M., Gooch K.E., Thomas S., White A.D., Humphries H.E., Wright D., Belij-Rammerstorfer S., Thakur N., Conceicao C., Watson R., Alden L., Allen L., Aram M., Bewley K.R., Brunt E., Brown P., Cavell B.E., Cobb R., Fotheringham S.A., Gilbride C., Harris D.J., Ho C.M., Hunter L., Kennard C.L., Leung S., Lucas V., Ngabo D., Ryan K.A., Sharpe H., Sarfas C., Sibley L., Slack G.S., Ulaszewska M., Wand N., Wiblin N.R., Gleeson F.V., Bailey D., Sharpe S., Charlton S., Salguero F.J., Carroll M.W, & Gilbert S.C. (2021). ChAdOx1 nCoV-19 protection against SARS-CoV-2 in rhesus macaque and ferret challenge models. Communications Biology, 4, 915.
+ Open protocol
+ Expand
4

SARS-CoV-2 Viral Load Detection by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) targeting a region of the SARS-CoV-2 nucleocapsid (N) gene was used to determine viral loads and was performed using TaqPathTM 1-Step RT-qPCR Master Mix, CG (Applied Biosystems), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies) and QuantStudio 7 Flex Real-Time PCR System. Sequences of the N1 primers and probe were: 2019-nCoV_N1-forward, 5’ GACCCCAAAATCAGCGAAAT 3’; 2019-nCoV_N1-reverse, 5’ TCTGGTTACTGCCAGTTGAATCTG 3’; 2019-nCoV-N1-probe, 5’ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3’. The cycling conditions were: 25°C for 2 min, 50°C for 15 min, 95°C for 2 min, followed by 45 cycles of 95°C for 3 s, 55°C for 30 s. The quantification standard was in vitro transcribed RNA of the SARS-CoV-2 N ORF (accession number NC_045512.2) with quantification between 1 x 101 and 1 x 106 copies/μL. Positive swab and fluid samples detected below the limit of quantification (LLOQ) of 12,857 copies mL, were assigned the value of 5 copies μL, this equates to 6,429 copies mL, whilst undetected samples were assigned the value of < 2.3 copies μL, equivalent to the assay’s lower limit of detection (LLOD) which equates to 2957 copies mL.
Ryan K.A., Bewley K.R., Watson R.J., Burton C., Carnell O., Cavell B.E., Challis A., Coombes N.S., Davies E.R., Edun-Huges J., Emery K., Fell R., Fotheringham S.A., Gooch K.E., Gowan K., Handley A., Harris D.J., Hesp R., Hunter L., Humphreys R., Johnson R., Kennard C., Knott D., Lister S., Morley D., Ngabo D., Osman K.L., Paterson J., Penn E.J., Pullan S.T., Richards K.S., Summers S., Thomas S.R., Weldon T., Wiblin N.R., Rayner E.L., Vipond R.T., Hallis B., Salguero F.J., Funnell S.G, & Hall Y. (2023). Syrian hamster convalescence from prototype SARS-CoV-2 confers measurable protection against the attenuated disease caused by the Omicron variant. PLOS Pathogens, 19(4), e1011293.
+ Open protocol
+ Expand
5

SARS-CoV-2 N Gene RT-qPCR Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) targeting a region of the SARS-CoV-2 nucleocapsid (N) gene was used to determine viral loads and was performed using TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies) and QuantStudio™ 7 Flex Real-Time PCR System. Sequences of the N1 primers and probe were: 2019-nCoV_N1-forward, 5’ GACCCCAAAATCAGCGAAAT 3’; 2019-nCoV_N1-reverse, 5’ TCTGGTTACTGCCAGTTGAATCTG 3’; 2019-nCoV_N1-probe, 5’ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3’. The cycling conditions were: 25 °C for 2 min, 50 °C for 15 min, 95 °C for 2 min, followed by 45 cycles of 95 °C for 3 s, 55 °C for 30 s. The quantification standard was in vitro transcribed RNA of the SARS-CoV-2 N ORF (NCBI Reference Sequence: NC_045512.2) with quantification between 1 × 101 and 1 × 106 copies/µl. Positive samples detected below the lower limit of quantification (LLOQ) were assigned the value of 5 copies/µl, whilst undetected samples were assigned the value of < 2.3 copies/µl, equivalent to the assays lower limit of detection (LLOD).
Proud P.C., Tsitoura D., Watson R.J., Chua B.Y., Aram M.J., Bewley K.R., Cavell B.E., Cobb R., Dowall S., Fotheringham S.A., Ho C.M., Lucas V., Ngabo D., Rayner E., Ryan K.A., Slack G.S., Thomas S., Wand N.I., Yeates P., Demaison C., Zeng W., Holmes I., Jackson D.C., Bartlett N.W., Mercuri F, & Carroll M.W. (2020). Prophylactic intranasal administration of a TLR2/6 agonist reduces upper respiratory tract viral shedding in a SARS-CoV-2 challenge ferret model. EBioMedicine, 63, 103153.
+ Open protocol
+ Expand
6

SARS-CoV-2 Viral Load Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
A reverse transcription-quantitative polymerase chain reaction (RT-qPCR) targeting a region of the SARS-CoV-2 nucleocapsid (N) gene was used to determine viral loads and was performed using TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies, Leuven, Belgium) and QuantStudio™ 7 Flex Real-Time PCR System. Sequences of the N1 primers and probe were: 2019-nCoV_N1-forward, 5′ GACCCCAAAATCAGCGAAAT 3′; 2019-nCoV_N1-reverse, 5′ TCTGGTTACTGCCAGTTGAATCTG 3′; 2019-nCoV_N1-probe, 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′. The cycling conditions were: 25 °C for 2 min, 50 °C for 15 min, 95 °C for 2 min, followed by 45 cycles of 95 °C for 3 s, and 55 °C for 30 s. Samples were run in duplicate. The quantification standard was in vitro transcribed RNA of the SARS-CoV-2 N ORF (accession number NC_045512.2) with quantification between 1 × 101 and 1 × 106 copies/µL.
Dowall S., Salguero F.J., Wiblin N., Fotheringham S., Hatch G., Parks S., Gowan K., Harris D., Carnell O., Fell R., Watson R., Graham V., Gooch K., Hall Y., Mizen S, & Hewson R. (2021). Development of a Hamster Natural Transmission Model of SARS-CoV-2 Infection. Viruses, 13(11), 2251.
+ Open protocol
+ Expand
7

SARS-CoV-2 Viral Load Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from nasal wash and throat swabs. Samples were inactivated in AVL and ethanol. Downstream extraction was then performed using the BioSprint96 One-For-All vet kit (Indical) and KingFisher Flex platform as per manufacturer’s instructions.
RT-qPCR targeting a region of the SARS-CoV-2 nucleocapsid (N) gene was used to determine viral loads and was performed using TaqPath 1-Step RT-qPCR Master Mix, CG (Applied Biosystems), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies), and QuantStudio 7 Flex Real-Time PCR System. Sequences of the N1 primers and probe were as follows: 2019-nCoV_N1-forward, 5′-GACCCCAAAATCAGCGAAAT-3′; 2019-nCoV_N1-reverse, 5′-TCTGGTTACTGCCAGTTGAATCTG-3′; 2019-nCoV_N1-probe, 5′-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3′. The cycling conditions were 25°C for 2 min, 50°C for 15 min, 95°C for 2 min, followed by 45 cycles of 95°C for 3 s, and 55°C for 30 s. The quantification standard was in vitro transcribed RNA of the SARS-CoV-2 N ORF (accession no. NC_045512.2) with quantification between 1 × 101 and 1 × 106 copies/μl. Positive samples detected below the limit of quantification were assigned the value of 5 copies/μl, while undetected samples were assigned the value of 2.3 copies/μl, equivalent to the assay’s lower limit of detection.
Bewley K.R., Gooch K., Thomas K.M., Longet S., Wiblin N., Hunter L., Chan K., Brown P., Russell R.A., Ho C., Slack G., Humphries H.E., Alden L., Allen L., Aram M., Baker N., Brunt E., Cobb R., Fotheringham S., Harris D., Kennard C., Leung S., Ryan K., Tolley H., Wand N., White A., Sibley L., Sarfas C., Pearson G., Rayner E., Xue X., Lambe T., Charlton S., Gilbert S., Sattentau Q.J., Gleeson F., Hall Y., Funnell S., Sharpe S., Salguero F.J., Gorringe A, & Carroll M. (2021). Immunological and pathological outcomes of SARS-CoV-2 challenge following formalin-inactivated vaccine in ferrets and rhesus macaques. Science Advances, 7(37), eabg7996.
+ Open protocol
+ Expand
8

SARS-CoV-2 N Gene Quantification by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) targeting a region of the SARS-CoV-2 nucleocapsid (N) gene was used to determine viral loads and was performed using TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies, Coralville, IA, USA) and QuantStudio™ 7 Flex Real-Time PCR System. Sequences of the N1 primers and probe were as follows: 2019-nCoV_N1-forward, 5′ GACCCCAAAATCAGCGAAAT 3′; 2019-nCoV_N1-reverse, 5′ TCTGGTTACTGCCAGTTGAATCTG 3′; 2019-nCoV_N1-probe, 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′. The cycling conditions were as follows: 25 °C for 2 min, 50 °C for 15 min, 95 °C for 2 min, followed by 45 cycles of 95 °C for 3 s, 55 °C for 30 s. The quantification standard was in vitro transcribed RNA of the SARS-CoV-2 N ORF (Accession Number NC_045512.2), with quantification between 1 × 101 and 1 × 106 copies/µL.
Fell R., Potter J.A., Yuille S., Salguero F.J., Watson R., Ngabo D., Gooch K., Hewson R., Howat D, & Dowall S. (2022). Activity of a Carbohydrate-Binding Module Therapy, Neumifil, against SARS-CoV-2 Disease in a Hamster Model of Infection. Viruses, 14(5), 976.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!