The double (5′ and 3′) digoxigenin (DIG)-labeled miR-100 probe and U6 probe were purchased from Exiqon. The normal mammary tissue and breast tumor sections were purchased from Origene (normal: CS807851; tumor: CS704488 and CS 711714). The tissue microarray (TMA) slide was purchased from Biomax (BR1006). In situ hybridization was performed according to the protocol of the miRCURY LNA microRNA ISH Optimization Kit (FFPE) (Exiqon). The stained slide was scanned on the Automated Cellular Image System III (ACIS III, Dako, Denmark) for quantification by digital image analysis. The color threshold was set up and standardized for all samples, and the color intensity was automatically scored for all individual cores on the TMA slide. The expression level was calculated from the score of color intensity and normalized to the internal control U6.
U6 probe
Manufactured by Qiagen
Sourced in Denmark
The U6 probe is a laboratory tool used for the detection and analysis of small nuclear RNA (snRNA) species. It is a short, synthetic DNA or RNA molecule designed to specifically bind to the U6 snRNA, which is a key component of the spliceosome, a complex that plays a crucial role in the processing of messenger RNA (mRNA) in eukaryotic cells. The U6 probe can be used in various molecular biology techniques, such as northern blotting, in situ hybridization, and RT-qPCR, to study the expression and localization of the U6 snRNA.
Automatically generated - may contain errors
Lab products found in correlation
Mircury lna microrna ish optimization kit ffpe, by Qiagen (1 mentions)
Automated cellular image system 3 acis 3, by Agilent Technologies (1 mentions)
Lna probe, by Qiagen (1 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
Mircury detection probe, by Qiagen (1 mentions)
4 protocols using u6 probe
1
Quantitative miRNA Expression Analysis
2
Northern Blotting for miRNA Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the mirVana miRNA isolation kit (Ambion) according to the manufacturer’s instructions. Northern blotting was carried out using DIG-labeled LNA Probes (from EXIQON) as described previously [30 (link)]. RNA-containing membranes were washed with DIG-WASH buffer followed by incubation with CSPD (Roche) at 37°C for 10 min. Membranes were exposed to X-ray film and developed. Membranes were reprobed with DIG-labelled U6 probe (Exiqon, Product No. 99002–15) as a loading control.
3
In Situ Detection of miR-30a-3p in Gastric Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ detection of miR-30a-3p was performed on paraffin sections using DIG-labeled miRCURYTM Detection probe according to the manufacturer’s instructions (Exiqon, Denmark). Thirty-one cases of GC and non-tumor adjacent tissues were selected. Sections were deparaffinized and deproteinated, which was followed by prehybridization, hybridization, a stringency wash and immunological detection. The sections were then exposed to a streptavidin-peroxidase reaction system and developed with 3,3ʹ-diaminobenzidine (DAB). The miR30a-3p probe had the sequence/5DigN/GCTGCAAACATCCGACTGAAAG/3Dig_N/(predicted Tm: 80°C, measured Tm: 52°C). A U6 probe (sequence: CACGAATTTGCGTGTCATCCTT, predicted Tm: 75°C, measured Tm: 62°C, Exiqon, Denmark) was used as the positive control and a 22-mer scrambled probe with a random sequence was included as a negative control. (GTGTAACACGTCTATACGCCCA, predicted Tm: 78°C, Exiqon, Denmark).
4
LNA-ISH for miR-615-5p Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LNA-ISH was performed according to the manufacturer’s protocol (Exiqon, Vedbaek, Denmark). The 5’-DIG- and 3’-DIG-labeled miRCURY LNA Detection probes for human mature miR-615-5p had the sequence 5’-GATCCGAGCACCGGGGACCCCC -3’. A U6 probe was used as positive control, while a scrambled probe was used as negative control; all probes were purchased from Exiqon. Four-micrometer-thin sections of FFPE tissues were mounted onto glass slides as previously described [25 (link)] and allowed to hybridize at 61°C.
Slides were independently scored by two experienced pathologists without preliminary knowledge of clinical data. Scoring levels were negative (-), weak, focally positive (1+), and strongly positive (2+). Staining scores were determined according to the following parameters: 2+, more than 50% of tumor cells showing strong staining (similar to normal acinar cells); 1+, less than or equal to 50% of tumor cells showing staining similar to acinar cells; negative, most to all tumor cells showing a staining weaker than normal staining in acinar cells [26 (link)].
Slides were independently scored by two experienced pathologists without preliminary knowledge of clinical data. Scoring levels were negative (-), weak, focally positive (1+), and strongly positive (2+). Staining scores were determined according to the following parameters: 2+, more than 50% of tumor cells showing strong staining (similar to normal acinar cells); 1+, less than or equal to 50% of tumor cells showing staining similar to acinar cells; negative, most to all tumor cells showing a staining weaker than normal staining in acinar cells [26 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!