The expression of Aii20J was performed as previously described33 (link),34 (link). Briefly, the E. coli BL21(DE3) plysS strain expressing the recombinant protein was inoculated into fresh LB medium with kanamycin (25 µg/mL) at 37 °C. The protein expression was induced when the culture reached 0.6 O.D. by the addition of 0.1 M Isopropyl-D-thiogalatopyranoside (IPTG) followed by further incubation of 5 h. Then, the culture was centrifuged, and the pellets were resuspended with 20 mL of PBS buffer, lysed by sonication on ice and centrifuged again. Aii20J was purified using the His GraviTrap affinity column (GE Healthcare) protein purification kit.
His gravitrap affinity column
Manufactured by GE Healthcare
The His GraviTrap affinity column is a laboratory tool designed for the purification of histidine-tagged proteins. It utilizes a nickel-charged resin to selectively bind and capture the target proteins, allowing for their subsequent elution and recovery.
Automatically generated - may contain errors
Lab products found in correlation
Gravitrap, by Cytiva (4 mentions)
Dh5α cells, by Thermo Fisher Scientific (1 mentions)
Pqe80l vector, by Qiagen (1 mentions)
Superdex 200 hr 10 30 column, by GE Healthcare (1 mentions)
E coli bl21 de3, by Thermo Fisher Scientific (1 mentions)
Bugbuster ht protein extraction reagent, by Merck Group (1 mentions)
Pgem t easy, by Promega (1 mentions)
Complete mini edta free protease inhibitor cocktail, by Roche (1 mentions)
4 protocols using his gravitrap affinity column
1
Recombinant Aii20J Protein Expression
2
Expression and Purification of Polyprotein Construct
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene encoding the polyprotein (I27)2-CD4D1D2-(I27)2 was constructed as described elsewhere.18 (link) The insert (I27)2-CD4D1D2-(I27)2 is constructed following a multistep cloning process using I27 and CD4D1D2 inserts with restriction sites BamHI, BglII, and KpnI. The final gene was cloned into pQE80L vector (Qiagen) and transformed in DH5α cells (Invitrogen). Protein expression was induced with 1 mM IPTG, and cells were incubated overnight in LB medium at 20 °C to avoid degradation. Cell pellets were disrupted using a French press and the His6-tagged proteins were loaded onto a His GraviTrap affinity column (GE Healthcare). The protein was further purified by size exclusion chromatography using a Superdex 200 HR 10/30 column from GE Healthcare. The protein was eluted in 10 mM HEPES at pH 7.2 containing 150 mM NaCl and 1 mM EDTA. The purified protein was verified by SDS-PAGE. The same protocol was used to express and purify human thioredoxin although expression was at 37 °C, and the cells used were E. coli BL21 (DE3) from Invitrogen.
3
Cloning and Purification of SEN4316 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sen4316 gene was amplified from wild type genomic DNA with primers sen4316 BamHI-fw (ggatccatgacaacaccatcctggcg) and sen4316 SalI-rv (gtcgactcatagggcgcgcatgtcgt), using Phusion High-Fidelity DNA Polymerase (Fermentas-Thermo Scientific). The PCR-amplified fragment was cloned in pGEM-T Easy (Promega), sequenced and digested with BamHI and SalI to clone it into the pET28a vector (Novagen). The resulting plasmid pET28a::sen4316 was electroporated into E. coli BL21 C43 (DE3) [31 (link)]. Cultures were grown at 37°C, 250 rpm, to an optical density (OD600) of 0.5, and isopropyl-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.4 mM. Cells were then grown overnight at 23°C. Harvested cells were lysed with BugBuster HT Protein Extraction Reagent (Merck Millipore). SEN4316 accumulated in inclusion bodies was obtained by centrifugation and suspension of insoluble material in CTAB 1%, incubation at room temperature for 1 h and recovery of the supernatant by centrifugation at 20,000 x g. This supernatant was dialyzed against binding buffer (20 mM sodium phosphate, 500 mM NaCl, 20 mM imidazole, pH 7.4) and the recombinant protein was purified with a His GraviTrap affinity column according to standard protocols (GE Healthcare). Eluted protein was dialyzed against sterile water, analyzed by SDS–PAGE and Western-Blot and lyophilized.
4
His-tagged Protein Expression in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type or mutated his-tagged proteins were expressed in E. coli BL21(DE3) strain transformed with recombinant plasmid pET21L12C-6His (a generous gift of Dr. S. Sanyal) or with mutagenized pET21L12C-6His. Cells were grown at 37°C in 1 liter of LB rich medium containing 50 µg.ml-1 ampicillin to 0.5 A600, after which induction with 0.2 mM isopropyl-ß-D-thiogalacto-pyranoside took place at 21°C with incubation up to 20 hours. After harvest, the cells were washed in PBS, sonicated 15 times for 10 s at 4°C in 30 ml buffer A (25 mM Tris-HCl pH 7.5, 0.5 M NaCl, 1 mM ß-ME, 10 mM Imidazole, 0.05% Tween 20, 1 mM MgCl2 containing 0.5 mg.ml-1 lysosyme, 100 µg.ml-1 DNase, one tablet of complete mini EDTA free protease inhibitor cocktail (Roche Diagnostics). The supernatant obtained by centrifugation (100,000 X g for 30 minutes) was applied two times on 1 ml His GraviTrap affinity column (GE Healthcare) equilibrated with buffer B (25 mM Tris-HCl pH 7.5, 0.5 M NaCl, 1 mM ß-ME, 10 mM Imidazole), the column was washed successively with buffer B containing 50 mM NaCl and 100 mM imidazole before elution of the protein with 8 ml of the same buffer containing 0.4 M imidazole. This fraction was concentrated by ultrafiltration, dialysed against buffer C (50 mM Tris-HCl pH 7.5, 0.3 M NaCl, 7 mM ß-ME, 50% glycerol) and stored at -25°C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!