Pcfd5 vector

Manufactured by Addgene

The PCFD5 vector is a plasmid used for gene expression and cloning. It contains a promoter, a multiple cloning site, and a selectable marker. The core function of the PCFD5 vector is to facilitate the insertion and expression of specific DNA sequences in host cells.

Automatically generated - may contain errors

Lab products found in correlation

In fusion hd cloning kit, by Takara Bio (2 mentions) Pdsred attp vector, by Addgene (1 mentions) Q5 high fidelity polymerase, by New England Biolabs (1 mentions)

5 protocols using pcfd5 vector

CRISPR-Mediated Gbp1 Null Mutant

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Gbp1^Δ null mutant was created by targeting two CRISPR-mediated double-stranded breaks to the Gbp1 gene locus (www.crisprflydesign.org). The following gRNAs were chosen:

#1)

ATTTGCTCCCATCATTTATC

#2)

CGGAAAACGATGCAGAAAGC

gRNAs sequences with extensions to allow for BbsI digestion were synthesized as single-stranded DNA oligos and annealed to form overhangs, then ligated to a pCFD5 vector (Addgene, #73914) digested with BbsI (NEB, #R3539S). Both plasmids were sequence-verified then injected by BestGene (Chino Hills, CA. USA) into vas-Cas9 expressing Drosophila embryos (Bloomington Stock 51324). vas-Cas9 was crossed out of progeny and mutants were identified by PCR for the presence of a Gbp1 deletion.
On sequencing, Gbp1^Δ was found to be missing 282 nucleotides, spanning the coding region corresponding to 94 amino acids from A22 to K116. This includes the C-terminal active peptide of the Gbp1 protein, which spans I95 to A118.

O’Connor J.T., Stevens A.C., Shannon E.K., Akbar F.B., LaFever K.S., Narayanan N.P., Gailey C.D., Hutson M.S, & Page-McCaw A. (2021). Proteolytic activation of Growth-Blocking Peptides triggers calcium responses through the GPCR Mthl10 during epithelial wound detection. Developmental cell, 56(15), 2160-2175.e5.

+ Open protocol

+ Expand

CRISPR-mediated sqh-StFP knock-in in Drosophila

Check if the same lab product or an alternative is used in the 5 most similar protocols

sqh-StFP was generated using CRISPR-mediated homologous recombination. gRNA (5′-TTACTGCTCATCCTTGTCCT-3′) was cloned into pCFD5 vector (Port et al., 2014 (link); Addgene #73914) and then the resulting vector was injected into the attP2 site (BDSC #25710). Subsequently, third chromosome insertion transgenic pCFD5-sqh flies were crossed into w^- backgrounds. To generate the donor vector, mScarlet-i and 2kb homology arms were amplified; then all three fragments were fused and cloned into the pBluescriptII KS(+) vector so that mScarlet-i was inserted just before the stop codon of the sqh gene. The donor vector was injected into embryos resulting from crossing nos-Cas9 (BDSC #78782 that had been crossed into a w^- background) and pCFD5-sqh flies. The mScarlet-i insertion was confirmed by sequencing and the sqh-StFP knock-in flies were viable and fertile.

Hui J., Nakamura M., Dubrulle J, & Parkhurst S.M. (2023). Coordinated efforts of different actin filament populations are needed for optimal cell wound repair. Molecular Biology of the Cell, 34(3), ar15.

+ Open protocol

+ Expand

CRISPR Guide RNA Cloning in pCFD5 Vector

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All the guide sequences of gRNAs were cloned into the pCFD5 vector (Addgene ##73914) according to the pCFD5 cloning protocol (Port and Bullock 2016 (link)). The guide sequences of gRNA1 (5′-GGAGCACGAGGTTCTGCGGG-3′) and gRNA2 (5′-GCGCGCTATTGTCCATTGGA-3′) were designed within exon 7 of ebony and cloned into separate pCFD5 vectors. The guide sequences of gRNA3 (5′-GTTAATAAGATCGGACAGAC-3′) and gRNA4 (5′-GAAAGTACTATCAATATACA-3′), which were designed at both ends of the approximately 900-bp priEE fragment (Fig. 1d and Supplementary Fig. 2), were cloned into a single plasmid. Two additional guide sequences, gRNA5 (5′-TGAATAGTGATCAGCTGGTG-3′) and gRNA6 (5′-TATGAGCATCCATATATCAG-3′), were designed within the priEE fragment (Supplementary Fig. 3) and cloned into another single plasmid including gRNA3 and gRNA4. An In-Fusion HD Cloning Kit (TaKaRa) was used for cloning.

Akiyama N., Sato S., Tanaka K.M., Sakai T, & Takahashi A. (2022). The role of the epidermis enhancer element in positive and negative transcriptional regulation of ebony in Drosophila melanogaster. G3: Genes|Genomes|Genetics, 12(3), jkac010.

+ Open protocol

+ Expand

Generation of CG14740 Null Mutant

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate a CG14740 null mutant, two gRNAs targeting the CG14740 coding sequence (gRNA 1: AGTGTTAATAGCGTGATTGGAGG, and gRNA 2: CTTATATTCCAGGTCATTCCCGG) were cloned into the pCFD5 vector (Addgene: Plasmid #73914, generated by ref. ^{125 (link)}). A 1.104 kb homology arm flanking the cleavage site 1 was PCR-amplified from genomic DNA using the Q5 high-fidelity polymerase from New England Biolabs (M0491S) and the following primers: 5’-AAAAGCTAGCTGGACAAAATCAGAACGGCA-3’ and 5’-AAAACCGCGGATCACGCTATTAACACTGATC-3’. The PCR product was digested with NheI and SacII prior to cloning into the pDsRedattP vector (Addgene: Plasmid #51019, generated by^{126 (link)}). A 1.186 kb homology arm flanking the cleavage site 2 was PCR-amplified from genomic DNA using the following primers: 5’-AAAACCTAGGTCCCGGCTACGGACACGCTG-3’and 5’-AAAACTCGAGACATGGAAGTGGAAAGGGGT-3’. The PCR product was digested with AvrII and XhoI prior to cloning into the pDsRedattP vector, containing the first homology arm. The constructs were sequence-verified and a mutant line was established through injection (Bestgene) of the 2 generated vectors (pCFD5 gRNAs and pDsRedattP homology arms) in yw;nos-Cas9 (FlyBase ID: FBti0156858, generated by^{127 (link)}) embryos. The generated deletion removed 1016 nucleotides (nt) of the CG14740 coding sequence and replaced it with an attP landing site and a loxP-flanked 3xP3-DsRed marker.

François C.M., Pihl T., Dunoyer de Segonzac M., Hérault C, & Hudry B. (2023). Metabolic regulation of proteome stability via N-terminal acetylation controls male germline stem cell differentiation and reproduction. Nature Communications, 14, 6737.

+ Open protocol

+ Expand

Multiple gRNA cloning into pCFD5 vector

Check if the same lab product or an alternative is used in the 5 most similar protocols

All the guide sequences of gRNAs were cloned into the pCFD5 vector (Addgene ##73914) according to the pCFD5 cloning protocol [56] (link). The guide sequences of gRNA1
(5'-GGAGCACGAGGTTCTGCGGG-3') and gRNA2 (5'-GCGCGCTATTGTCCATTGGA-3') were designed within exon 7 of ebony and cloned into separate pCFD5 vectors. The guide sequences of gRNA3 (5'-GTTAATAAGATCGGACAGAC-3') and gRNA4
(5'-GAAAGTACTATCAATATACA-3'), which were designed at both ends of the approximately 970-bp priEE fragment (Fig S5, [28, (link)29] (link)), were cloned into a single plasmid. An In-Fusion HD Cloning Kit (TaKaRa) was used for cloning.

Akiyama N., Sato S., Tanaka K.M., Sakai T., & Takahashi A. (2021). A silencer repressing redundant enhancer activities revealed by deleting endogenouscis-regulatory element ofebonyinDrosophila melanogaster.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!