Un scan it gel version 5

In order to extract the protein from the SW480 cells, the cells were washed three times with cold 1 × PBS, the cells were recovered with RIPA buffer (Boston Bio Products, Ashland, MA, USA) containing protease and phosphatase inhibitor (Sigma-Aldrich), and left at 4 °C for 30 min. After 30 min, cells were centrifuged at 15,000 × rpm at 4 °C for 10 min and the supernatant was taken for protein determination. Protein content was analyzed by BCA protein assay (Pierce, Rockford, IL, USA). The equal amount of protein was separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The membrane was blocked in 5% non-fat dry milk in Tris-buffered saline containing 0.05% Tween 20 (TBS-T) for 1 h at room temperature. Each primary antibody was treated to PVDF membrane using 5% non-fat dry milk in TBS-T at 4 °C for 16 h. After washing with TBS-T, PVDV membrane was incubated with the secondary antibody for 1 h at room temperature. Then, after washing with TBS-T, the protein band was luminescent with ECL Western blotting substrate (Amersham Biosciences, Piscataway, NJ, USA) and visualized using LI-COR C-DiGit Blot Scanner (Li-COR Biosciences, Lincoln, NE, USA). The density of protein bands was calculated by UN-SCAN-IT gel version 5.1 (Silk Scientific Inc. Orem, UT, USA).

After treatment, the cells were washed twice with cold 1 × phosphate-buffered saline (PBS), and the cellular proteins were extracted using radioimmunoprecipitation assay (RIPA) buffer (Boston Bio Products, Ashland, MA, USA) supplemented with protease inhibitor cocktail (Sigma-Aldrich) and phosphatase inhibitor cocktail (Sigma-Aldrich). The concentration of the proteins extracted from the cells was quantified using BCA protein assay (Thermo Fisher Scientific, Waltham, MA USA). The equal protein (30 μg/well) was separated on SDS-PAGE and transferred to PVDF membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The PVDF membranes were blocked with 5% non-fat dry milk in Tris-buffered saline containing 0.05% Tween 20 (TBS-T) by stirring at room temperature for 1 h and then incubated with specific primary antibodies (1:1000) in 5% non-fat dry milk in 0.05% TBS-T at 4 °C for 16 h. After 16 h, the PVDF membranes were washed three times for 5 min with 0.05% TBS-T, and then incubated with horse radish peroxidase-conjugated immunoglobulin G (1:1000) for 1 h at room temperature. Chemiluminescence was detected with ECL Western blotting substrate (Amersham Biosciences, Piscataway, NJ, USA) and visualized in Polaroid film. The density of Western blot bands was calculated using the software UN-SCAN-IT gel version 5.1 (Silk Scientific Inc. Orem, UT, USA).

RT‐PCR was performed according to the protocol of our previous study (Son et al., 2020 (link)). The isolation of total RNA from 3T3‐L1 cells and the synthesis of cDNA using the isolated total RNA were carried out using a RNeasy Mini Kit (Valencia) and a Verso cDNA Kit (Thermo Scientific), respectively. The amplification of the target gene was performed using a PCR Master Mix Kit (Promega) and the primers. The sequences of the primers used in this study were as follows: PPARγ: forward 5’‐gaaagacaacggacaaatcacc‐3’ and reverse 5’‐gggggtgatatgtttgaacttg‐3’, CEBPα: forward 5’‐ttacaacaggccaggtttcc‐3’ and reverse 5’‐aactccagtccctctgggat‐3’, and GAPDH: forward 5’‐ggactgtggtcatgagcccttcca‐3’ and reverse 5’‐actcacggcaaattcaacggcac‐3’. The PCR results were visualized using agarose gel electrophoresis. The density of bands for PCR products (DNA) was calculated using the software UN‐SCAN‐IT gel version 5.1 (Silk Scientific Inc).

Western blot analysis was performed according to the protocol of our previous study (Son et al., 2020 (link)). The samples for SDS‐polyacrylamide gel electrophoresis (SDS‐PAGE) were prepared by extracting proteins from 3T3‐L1 cells with radio‐immunoprecipitation assay buffer (Boston Bio Products) containing protease inhibitor (Sigma‐Aldrich) and phosphatase inhibitor (Sigma‐Aldrich) and quantifying the protein amounts by BCA assay (Thermo Fisher Scientific). After sample preparation, the protein (25 μg/well) was separated by SDS‐PAGE, and then proteins separated on the gel were transferred to the polyvinylidene fluoride (PVDF) membrane. After the transfer, the PVDF membrane was blocked with 5% nonfat milk in Tris‐buffered saline containing .05% Tween 20 (TBS‐T) at room temperature for 1 hr, and then, the PVDF membranes were treated with the primary antibodies in 5% bovine serum albumin in TBS‐T at 4ºC for overnight. After the primary antibody treatment was completed, the PVDF membranes were treated with the secondary antibodies in 5% nonfat milk in TBS‐T at room temperature for 1 hr. Chemiluminescence was detected with ECL Western blotting substrate (Amersham Biosciences) and visualized using LI‐COR C‐DiGit Blot Scanner (Li‐COR Biosciences). The density of Western blot bands was calculated using the software UN‐SCAN‐IT gel version 5.1 (Silk Scientific Inc.).

To isolate total RNA from SW480 cells after each treatment, the cells were washed three times with cold 1 × PBS, and then total RNA was taken by a RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Contents of tatal RNA were measured by UV spectrophotometer (GeneQuant 1300, GE Healthcare Life Sciences, Marlborough, MA, USA). cDNA was synthesized from 1 μg of total RNA using a Verso cDNA Kit (Thermo Scientific, Pittsburgh, PA, USA). To amplify the cDNA, PCR was performed using PCR Master Mix Kit (Promega, Madison, WI, USA). The primer sequences of cyclin D1 and GAPDH were as followed: cyclin D1: forward 5’-AACTACCTGGACCGCTTCCT-3′ and reverse 5’-CCACTTGAGCTTGTTCACCA-3′, GAPDH: forward 5’-ACCCAGAAGACTGTGGATGG-3′ and reverse 5’-TTCTAGACGGCAGGTCAGGT-3′. The density of mRNA bands was calculated by UN-SCAN-IT gel version 5.1 (Silk Scientific Inc. Orem, UT, USA).

After the sample treatment was completed, the RAW264.7 cells were washed 3 time with cold 1 × PBS, and then the cells were lysed for 30 min at 4°C using RIPA buffer (Boston Bio Products) containing protease inhibitor (Sigma‐Aldrich) and phosphatase inhibitor (Sigma‐Aldrich) to extract cellular proteins from the cells. After 30 min, protein was quantified by BCA protein assay (Thermo Fisher Scientific) using a clear supernatant obtained by centrifugation at 4°C for 10 min. Then, the protein was separated by SDS‐PAGE and subsequently transferred to the PVDF membrane. After blocking the PVDF membrane for 1 hr by stirring at room temperature with a blocking buffer (5% not‐fat dry milk in Tris‐buffered saline containing 0.05% Tween 20 (TBS‐T), the primary antibody was treated and reacted with stirring at 4°C overnight. Then, after washing PVDF membrane with TBS‐T, the secondary antibody was treated and reacted at room temperature for 1 hr. After washing PVDF membrane with TBS‐T, Chemiluminescence was detected with ECL Western blotting substrate (Amersham Biosciences) and visualized using LI‐COR C‐DiGit Blot Scanner (Li‐COR Biosciences). The density of Western blot bands was calculated using the software UN‐SCAN‐IT gel version 5.1 (Silk Scientific Inc.).

After the sample treatment was completed, the RAW264.7 cells were washed three time with cold 1 × PBS. Total RNA was extracted from the cells using a RNeasy Mini Kit, and after quantitation of total RNA, cDNA was synthesized using a Verso cDNA Kit (Thermo Scientific) from 1 μg of total RNA. Then, the target genes were amplified using a PCR Master Mix Kit (Promega) and the primers. The sequences of the primers used in this study were as follows: iNOS: forward 5′‐ttgtgcatcgacctaggctggaa‐3′ and reverse 5′‐gacctttcgcattagcatggaagc‐3′, IL‐1β: forward 5′‐ggcaggcagtatcactcatt‐3′ and reverse 5′‐cccaaggccacaggtattt‐3′, IL‐6: forward 5′‐gaggataccactcccaacagacc‐3′ and reverse 5′‐aagtgcatcatcgttgttcataca‐3′, IL‐12: forward 5′‐aaccagacccgcccaagaac‐3′ and reverse 5′‐gatcctgagcttgcacgcaga‐3′, TNF‐α: forward 5ʹ‐tggaactggcagaagaggca‐3ʹ and reverse 5ʹ‐tgctcctccacttggtggtt‐3ʹ, MCP‐1: forward 5′‐ggaaaaatggatccacaccttgc‐3′ and reverse 5′‐tctcttcctccaccaccatgcag‐3′, GAPDH: forward 5′‐ggactgtggtcatgagcccttcca‐3′ and reverse 5′‐actcacggcaaattcaacggcac‐3′. The PCR results were visualized using agarose gel electrophoresis. The density of mRNA bands was calculated using the software UN‐SCAN‐IT gel version 5.1 (Silk Scientific Inc.).