Puc57

Manufactured by GenScript

Sourced in United States, China

The PUC57 is a plasmid vector used for gene cloning and expression in E. coli. It features a pUC origin of replication and a multiple cloning site, allowing for the insertion and expression of foreign DNA.

Automatically generated - may contain errors

Lab products found in correlation

55 protocols using puc57

Recombinant Baculovirus Codon Optimization

Check if the same lab product or an alternative is used in the 5 most similar protocols

CTLT (Figure S1) and THB (Figure S2) codon-optimized coding sequences based on the preference of the BmNPV codons were synthesized by GenScript Biotech Corp (Nanjiang, China), and cloned into the vector, pUC57-T (GenScript, Nanjiang, China), to generate pUC57-CTLT and pUC57-THB, respectively.

Yu L., Pan J., Cao G., Jiang M., Zhang Y., Zhu M., Liang Z., Zhang X., Hu X., Xue R, & Gong C. (2020). AIV polyantigen epitope expressed by recombinant baculovirus induces a systemic immune response in chicken and mouse models. Virology Journal, 17, 121.

+ Open protocol

+ Expand

Construction of Dual-Detargeted Plasmid for miRNA Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pF/R-wt and RZ-pMwt plasmids were kind gifts from Ann C. Palmenberg (University of Wisconsin, Department of Biochemistry and the Institute for Molecular Virology), and their construction has been described already (26 (link), 27 (link)). The cytomegalovirus (CMV) promoter from pF/R-wt was cloned into RZ-pMwt to obtain pCMV-RZ-Mwt. A double-stranded DNA (dsDNA) fragment containing nucleotides (nt) 43 to 105, C₁₃UC₁₀, and nt 203 to 335 (numbering based on RZ-pMwt) was synthesized and cloned into pUC57 (GenScript, Piscataway, NJ). The fragment was subcloned into pCMV-RZ-Mwt at EcoRV and AvrII sites (pMC₂₄). miRNA sequences were obtained from Sanger Institute miRBase. Two copy inserts were cloned into pMC₂₄ using splice-overlap extension (SOE) PCR. Two complementary single-stranded oligonucleotides encoding 3 or 4 copies of miRNA target inserts flanked by NheI or XhoI restriction site overhang sequences were annealed in T4 DNA ligase buffer (B0202S; NEB, MA) by heating to 85°C and slowly cooling to 25°C. NheI and XhoI sites were cloned upstream of pCT and into the 3′ NCR at position 7617 of pMC₂₄, respectively, using SOE PCR, allowing the insertion of annealed oligonucleotides. Dual-detargeted pMC₂₄ was generated by ligating together fragments from individually targeted plasmids at EcoRV and AvrII sites. The integrity of the targets was verified by sequencing.

Ruiz A.J., Hadac E.M., Nace R.A, & Russell S.J. (2016). MicroRNA-Detargeted Mengovirus for Oncolytic Virotherapy. Journal of Virology, 90(8), 4078-4092.

+ Open protocol

+ Expand

Engineered Lrh Riboswitch Regulates GFPuv Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

A synthetic DNA insert comprising the desired wild-type Lrh riboswitch sequence (Figs. 3a,b) was prepared in pUC57 (GenScript Inc) and sub-cloned into the pEnv8(GAAA) vector^{28 (link)} (AddGene) using NsiI and HindIII (NEB) restriction sites. The resulting plasmid, pBR327-Lrh(WT)-GFPuv, was amplified in E. coli DH5α. A positive control was also prepared in which the GFPuv gene is expressed constitutively. This plasmid lacks the Lrh preQ₁-II riboswitch (i.e., powder blue sequence; Fig. 3a). This “gene on” control sequence is: 5´-AACTATTAACTGAATCAAGGAGAAACAATATG-3´, which follows the Pribnow box. The underlined sequence is the Lrh RBS and the bold sequence is the GFPuv start codon. A negative control vector was prepared by replacing the RBS of the positive control with its reverse complement: 5´-CUCCUU-3´.

Dutta D., Belashov I.A, & Wedekind J.E. (2018). Coupling Green Fluorescent Protein Expression with Chemical Modification to Probe Functionally Relevant Riboswitch Conformations in Live Bacteria. Biochemistry, 57(31), 4620-4628.

+ Open protocol

+ Expand

Cloning and Expression of Protein M-HRP Fusion

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 3

The mature amino acid sequence of horseradish peroxidase HRP (31-338 amino acid) was generated containing a myc-tag (EQKLISEEDL) and linker (AAN) sequence at its N-terminal end. The amino acid sequence encoding 3 sets of 4 glycine residues and 1 serine residue (e.g., GGGGS)3 linker followed by the mature amino acid sequence of Protein M (37-556 amino acid) was added to its C-terminal end producing a final Protein M-HRP construct containing (IL-2 leader sequence—myc tag—HRP—linker—Protein M). The linear amino acid sequence was reverse translated to its corresponding DNA sequence using the free GenSmart™ Codon Optimization Tool by GenScript for expression in human cells (gensmart-free-gene-codon-optimization). This sequence was submitted for gene synthesis and inserted into the plasmid cloning vector pUC57 (GenScript USA Inc.). The insert was amplified and cloned into a mammalian cell expression vector, pcDNA3(−). The plasmid expression vector construct was verified by restriction enzyme analysis, amplified in E. coli and purified using a maxiprep kit (GenScript Inc. and Eton Bioscience, Inc.).

US11401309B2. Protein M fusion proteins and uses (2022-08-02). None [US]. Inventors: Jay Dela Cruz [US].

+ Open protocol

+ Expand

Hendra Virus G Polypeptide Expression in Equus caballus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 1

The synthetic Hendra virus G polypeptide (SEQ ID NO:2) optimized for expression in Equus caballus was cloned into pUC57 (GenScript Corporation, New Jersey, USA) vector. The EcoRV/KpnI fragment containing Hendra virus G fragment from the pUC57 vector was cloned into pCXL-148-2 (Merial Limited proprietary material) containing vaccinia H6 promoter resulting in plasmid p362-Hendra G (see FIG. 2 plasmid map).

US10350287B2. Hendra virus recombinant compositions and uses thereof (2019-07-16). BOEHRINGER INGELHEIM ANIMAL HEALTH USA INC. [US]. Inventors: Jean-Christophe Audonnet [FR], Jules Maarten Minke [FR], Teshome Mebatsion [US], Catherine Charreyre [FR].

+ Open protocol

+ Expand

Cloning and Expression of IMT-CBD-mCherry

Check if the same lab product or an alternative is used in the 5 most similar protocols

E. coli Top10 cells were used for all cloning experiments. Codon optimized sequence of IMT-CBD-mC for expression in E. coli was obtained from Genscript® with the CBD of Cellulomonas fimi cenA (N-terminal 115 amino acids coding gene sequence) placed upstream to, and separated from mCherry gene sequence, by 8X glycine linker GGTGGTGGTGGTGGCGGAGGTGGT and a HindIII site, flanked by BamHI and XhoI 5’ and 3’ terminally respectively, in pUC57 (Genscript, Piscataway, N.J., USA) vector. The sequence was subcloned into a pET28a (Novagen, Merck KGaA, Darmstadt, Germany) vector and was used to clone IMT-CBD-mC in pET28a to obtain pET28a-CBD-mC.

Mavi P.S., Singh S, & Kumar A. (2023). Media component bovine serum albumin facilitates the formation of mycobacterial biofilms in response to reductive stress. BMC Microbiology, 23, 111.

+ Open protocol

+ Expand

Cloning Chikungunya Structural Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CHIKV structural protein genes, capsid-E3-E2-6K-E1, encoding 3747 bp were obtained from two different sources. One was the synthetic genes consisting of human-preferred codons based on the amino acid sequence of CHIKV strain 37997 obtained from GenBank (accession number EU224270), which were inserted into a plasmid pUC57 (GenScript, Piscataway, NJ) as described [18] (link). The optimized fragment was subcloned into an expression vector, pcDNA3.1/zeo⁺ (Invitrogen, Carlsbad, CA), using BamHI and NotI sites to construct pcDNA3.1/zeo(+).optimized. The other source was a CHIKV strain isolated from a Thai patient in 2009. A forward primer containing a BamHI site (underlined), 5′-ATATTTGGATCCAATGGAGTTCATCCCAACCCAAACT-3′, and a reverse primer containing a NotI site (underlined), 5′-TATATTGCGGCCGCTTAGTGCCTGCTGAACGACACGCA-3′ were used to amplify a fragment encoding the structural proteins, which was cloned into pCR-XL-TOPO (Invitrogen) and subcloned into the expression vector, pCDNA3.1/zeo⁺, using the same strategy described above to construct pcDNA3.1/zeo(+).natural. Both the optimized and natural sequences were verified by sequencing (ABI 3100, Applied Biosystems, Foster City, CA) (Fig. 1).

Noranate N., Takeda N., Chetanachan P., Sittisaman P., A-nuegoonpipat A, & Anantapreecha S. (2014). Characterization of Chikungunya Virus-Like Particles. PLoS ONE, 9(9), e108169.

+ Open protocol

+ Expand

Yeast Expression of DENV NS1 Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene sequences encoding NS1 proteins were synthesized and optimized for expression in yeast using cloning vector pUC57 (GenScript, Piscataway, NJ, USA). Each gene was inserted between two specific restriction sites independently in the pPICZαA vector: EcoRI and NotI (DENV1, 3 and 4) and KpnI and NotI (DENV2). Constructs (pPICZαA_NS1-DENV1–4) were linearized with SacI and used in P. pastoris KM71H transformation by electroporation. Transformants were selected on Zeocin™-resistant YPDS (1% yeast extract, 2% peptone, 2% d-glucose, and 18.2% sorbitol) at different antibiotic concentrations (100, 200, and 500 μg/mL), as described in the Easy Select Pichia Expression kit (Invitrogen). Genomic DNA of the transforming clones was extracted, according to Looke and Kristjuhan [52 (link)], with minor modifications, and insertion was confirmed by PCR using specific primers for AOX1: AOX1sense (5′gactggttccaattgacaagc3′) and AOX1antisense (5′gcaaatggcattctgacatcc3′).

Xisto M.F., Prates J.W., Dias I.M., Dias R.S., da Silva C.C, & de Paula S.O. (2020). NS1 Recombinant Proteins Are Efficiently Produced in Pichia pastoris and Have Great Potential for Use in Diagnostic Kits for Dengue Virus Infections. Diagnostics, 10(6), 379.

+ Open protocol

+ Expand

Construction of Versatile Vaccinia Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols

A plasmid was designed to mediate the reinsertion of the A27L gene, together with foreign sequences, into the A27L locus. This plasmid (pA-LE-R_R), containing A27L recombination flanks (566 and 551 bp), the A27L gene and an early/late promoter^{24 (link),25 (link)}, was obtained by synthesis of a DNA fragment and subsequent cloning in plasmid pUC57 (done by Genscript Corp). Subsequently, pA-LE-Scarlet-NES was obtained by insertion of the gene coding for mScarlet-i from pRB-Scarlet into the EcoRI/BamHI sites of pA-LE-R_R (Sanchez-Puig et al., in preparation). Then, plasmid pA.S-TagGFP2 was obtained by substituting the promoter-Scarlet gene cassette by the synthetic E/L promoter-TagGFP2 gene cassette derived from pRB-TagGFP2 (Supplementary Info). Finally, plasmid pA.S was obtained by inserting the synthetic E/L promoter-multiple cloning site region from pRB21 between the XhoI and BamHI sites in pA.S-TagGFP2.

Lorenzo M.M., Sánchez-Puig J.M, & Blasco R. (2019). Genes A27L and F13L as Genetic Markers for the Isolation of Recombinant Vaccinia Virus. Scientific Reports, 9, 15684.

+ Open protocol

+ Expand

Heterologous Protein Expression in Streptomyces

Check if the same lab product or an alternative is used in the 5 most similar protocols

E. coli TOP10 F’ (Invitrogen, a strain with wt genes coding for for Fhu and OmpW), and cloning vectors pUC57 (GenScript) and pIAGO [38 (link)] were used for routine sub-cloning while Streptomyces albus was used as host for heterologous protein expression. E. coli clones were incubated at 37°C and 250 rpm in TSB (Tryptic Soy Broth, Merck) or LB (Luria-Bertani Broth, Merck) for growing in liquid medium, and TSB containing agar was used for growing on solid medium. Appropriate concentrations of antibiotics were added for plasmid selection: 100 μg/mL ampicillin for both vectors. S. albus was sporulated on Bennet medium [39 ] at 30°C and grown in liquid YEME medium for protoplasts preparation [40 ]. Transforming colonies were cultured at 30°C on R5 solid medium, sporulated on Bennet medium and subcultured in R5A liquid medium [41 (link)] for protein expression. Spores were kept in glycerol 25% at -20°C. Media were supplemented with thiostrepton at 5 or 50 μg/mL (liquid or solid cultures respectively). Enterobacter cloacae (strain CECT 194T) and Salmonella enterica var. arizonae (strain CECT 4395) were used as negative controls, and have been grown in TSB medium as well.

Gutiérrez-del-Río I., Marín L., Fernández J., Álvarez San Millán M., Ferrero F.J., Valledor M., Campo J.C., Cobián N., Méndez I, & Lombó F. (2018). Development of a biosensor protein bullet as a fluorescent method for fast detection of Escherichia coli in drinking water. PLoS ONE, 13(1), e0184277.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!