Quant it ribogreen kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, France

The Quant-iT™ RiboGreen® kit is a reagent used for quantifying RNA in solution. It utilizes a fluorescent dye that binds to RNA, allowing for the measurement of RNA concentration through fluorescence detection.

Automatically generated - may contain errors

Lab products found in correlation

Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Hiseq 4000 platform, by Illumina (1 mentions) Ambion rnaqueous micro kit, by Thermo Fisher Scientific (1 mentions) Agilent 6000 pico labchip, by Agilent Technologies (1 mentions) Nebnext oligo dt 25 beads, by New England Biolabs (1 mentions) Agilent 2100 bioanalyzer rna 6000 pico kit, by Agilent Technologies (1 mentions) Agilent 2100 bioanalyzer small rna kit, by Agilent Technologies (1 mentions) Trizol plus rna purification kit, by Thermo Fisher Scientific (1 mentions) Cfx96 touch thermocycler, by Bio-Rad (1 mentions) Itaq universal sybr green one step kit, by Bio-Rad (1 mentions) Direct zol rna miniprep plus kit, by Zymo Research (1 mentions) Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions) Rna 6000 pico kit, by Agilent Technologies (1 mentions) Small rna kit, by Agilent Technologies (1 mentions) Nanovue spectrophotometer, by GE Healthcare (1 mentions) Thermo scientific flash 2000 chns o, by Thermo Fisher Scientific (1 mentions) Magnetic mrna isolation kit, by New England Biolabs (1 mentions) Tapestation 2200 r6k, by Agilent Technologies (1 mentions) Taqman assay, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

RiboGreen (90 citations) Quant-IT RiboGreen (49 citations)

8 protocols using quant it ribogreen kit

Transcriptomic Analysis of Arabidopsis Leaves

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using the Ambion^® RNaqueous^® micro kit (ThermoFisher Scientific) according to manufacturer’s instructions. RNA quality was analyzed using the Agilent 6000 Pico LabChip^® and Agilent 2100 Bioanalyzer software (Agilent Technologies, USA). RNA quantity was determined using the Quant-iT™ RiboGreen^® kit (ThermoFisher Scientific) according to manufacturer’s instructions. NEBNext Oligo d(T)₂₅ beads (New England BioLabs, Ipswich, MA, USA) were used for mRNA purification. cDNA library synthesis was performed according to Ziegler et al.^{64 (link)} with three biological replicates per treatment each containing three A. thaliana leaves. Subsequently, 100 bp paired-end RNA sequencing was performed on the Illumina HiSeq4000 platform (Génome Québec Innovation Centre, McGill University, Montreal, Canada).

Walker P.L., Ziegler D.J., Giesbrecht S., McLoughlin A., Wan J., Khan D., Hoi V., Whyard S, & Belmonte M.F. (2023). Control of white mold (Sclerotinia sclerotiorum) through plant-mediated RNA interference. Scientific Reports, 13, 6477.

+ Open protocol

+ Expand

Robust Small RNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using a TRIzol Plus RNA Purification Kit (Life Technologies, 12183555) according to the manufacturer's protocol. After verifying the quality of total RNA using an Agilent 2100 Bioanalyzer RNA 6000 Pico Kit (Agilent Technologies), we proceeded to the second part of the protocol, small RNA enrichment from total RNA by increasing the ethanol content of the sample, followed by isolation over a glass‐fibre filter and elution. Thereafter, the quality of the small RNA samples was analysed using an Agilent 2100 Bioanalyzer Small RNA Kit (Agilent Technologies). RNA total concentration was measured using NanoDrop, and miRNA concentration was analysed using the Quant‐iT RiboGreen Kit (Thermo Scientific).

Song S., Long M., Yu G., Cheng Y., Yang Q., Liu J., Wang Y., Sheng J., Wang L., Wang Z, & Xu B. (2019). Urinary exosome miR‐30c‐5p as a biomarker of clear cell renal cell carcinoma that inhibits progression by targeting HSPA5. Journal of Cellular and Molecular Medicine, 23(10), 6755-6765.

+ Open protocol

+ Expand

Quantitative RT-PCR Protocol for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using the Trizol reagent (ThermoFisher Scientific, Inc. Waltham, MA) in conjunction with the Direct-zol RNA MiniPrep Plus kit (Zymo Research, Orange, CA), including the DNase treatment for removal of residual genomic DNA, according to the manufacturer’s recommendations. RNA concentration and purity were determined by UV absorption at 260 nm, with 260/280 ratios between 1.9 and 2.1. Quantitative RT-PCR (qPCR) was carried out using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad Laboratories, Hercules, CA) with 10 ng of RNA per reaction using a CFX96 Touch thermocycler (Bio-Rad Laboratories, Hercules, CA). Relative expression was determined using the ΔΔCt method after normalizing expression to total RNA measured with the Quant-iT RiboGreen kit (ThermoFisher Scientific, Inc. Waltham, MA). Table 1 lists all the primers used in this study; confirmation of specific, efficient amplification was carried out in our laboratory before their use.

Zhang X., Hashimoto J.G., Han X., Zhang F., Linhardt R.J, & Guizzetti M. (2021). Characterization of Glycosaminoglycan Disaccharide Composition in Astrocyte Primary Cultures and the Cortex of Neonatal Rats. Neurochemical research, 46(3), 595-610.

+ Open protocol

+ Expand

Exosomal miRNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

miRNA extraction from exosome pellet was performed with mirVana miRNA isolation kit (Ambion) according to manufacturer instructions in two steps process. First, exosomes were lysed and after organic extraction, total RNA was isolated over glass-fiber filter and eluted. The quality of the total RNA was assessed by Agilent 2100 Bioanalyzer using an RNA 6000 Pico Kit (Agilent Technologies). After verifying the quality of RNA, we proceeded to the second part of the protocol of small RNA enrichment from total RNA by increasing ethanol content of the sample and isolation over glass-fiber filter and elution. Later, quality of the small RNA samples was analyzed by Agilent 2100 Bioanalyzer using a Small RNA kit (Agilent Technologies). RNA total concentration was measured by Nanodrop, and miRNA concentration was measured analyzed with the Quant-iT RiboGreen Kit (Invitrogen).

Sánchez C.A., Andahur E.I., Valenzuela R., Castellón E.A., Fullá J.A., Ramos C.G, & Triviño J.C. (2015). Exosomes from bulk and stem cells from human prostate cancer have a differential microRNA content that contributes cooperatively over local and pre-metastatic niche. Oncotarget, 7(4), 3993-4008.

+ Open protocol

+ Expand

Comprehensive Elemental Analysis of EPS

Check if the same lab product or an alternative is used in the 5 most similar protocols

Elemental analysis for the determination of C, H, N, and O in the extracted EPS was performed according to the modified protocol with an organic element analyzer (Thermo Scientific FLASH ™ 2000 CHNS/O, Thermo Fisher Scientific, Massachusetts, USA). The determination of the amount of C, H, and N was carried out by total pyrolysis of the analytical sample at 1800 °C in the presence of oxygen. The oxygen content was detected by total pyrolysis of the EPS sample at 1080 °C under a stream of nitrogen. The total chlorine was quantified by using high-pressure ion chromatography (HPIC, Waters). Total monosaccharide content was assayed by phenol-sulfuric acid methods with glucose as standard [46 (link)]. Uronic acids were quantified using the colorimetric method of meta-hydroxydiphenyl [47 (link)]. RNA detection was performed using the Nanovue spectrophotometer (GE Healthcare) and also verified with the “Quant-it™ RiboGreen^®” kit (Invitrogen, Waltham/ Massachusetts, USA).

Jivkova D., Sathiyanarayanan G., Harir M., Hertkorn N., Schmitt-Kopplin P., Sanhaji G., Fochesato S., Berthomieu C., Heyraud A., Achouak W., Santaella C, & Heulin T. (2022). Production and Characterization of a Novel Exopolysaccharide from Ramlibacter tataouinensis. Molecules, 27(21), 7172.

+ Open protocol

+ Expand

RNA-Seq Library Preparation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA quantity and integrity were assessed using Quant-IT RiboGreen Kit (Invitrogen) and Agilent Tapestation 2200R6K. mRNA enrichment was achieved from 400-900ng of total RNA using a Magnetic mRNA Isolation Kit (NEB). Generation of double stranded cDNA and library construction were performed using NEBNext® mRNA Sample Prep Reagent Set 1 (NEB).
Ligation of adapters was performed using Adapters prepared at the WTCHG according to the Illumina design (Multiplexing Sample Preparation Oliogonucleotide Kit). Each library was subsequently size selected with two Ampure Bead bindings. The following custom primers were used for PCR enrichment: MultiplexPCRprimer1.0 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA TCT-3'. Indexprimer: 5'-

Martínez-Sánchez A., Lazzarano S., Sharma E., & Murphy C.L. (2020). High through-put identification of miR-145 targets in human articular chondrocytes.

+ Open protocol

+ Expand

Plasma miRNA Isolation and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Circulating miRNA was isolated from 400 μl of plasma utilizing miRNeasy kit (Qiagen, Valencia, CA). After addition of the lysis reagent, 2.5 fmol of synthetic C. elegans miRNAs (cel-39, cel-54 and cel-238) were added to the samples as spike-in normalization controls as previously described [37 (link)]. Circulating miRNA levels were assessed using: a) the miR-ID® platform (Somagenics, Santa Cruz, CA) [42 (link)] for the data represented in Figure 3A, or b) TaqMan assays (Life Technologies, Grand Island, NY) in Phase II trial patients. Data was normalized utilizing spike-in controls or RNA concentration (determined using Quant-iT RiboGreen kit, Life Technologies), respectively. Relative expression was calculated utilizing the delta-delta Ct (ΔΔCt) method [43 (link)].

Krysan K., Kusko R., Grogan T., O'Hearn J., Reckamp K.L., Walser T.C., Garon E.B., Lenburg M.E., Sharma S., Spira A.E., Elashoff D, & Dubinett S.M. (2014). PGE2-driven Expression of c-Myc and OncomiR-17-92 Contributes to Apoptosis Resistance in NSCLC. Molecular cancer research : MCR, 12(5), 765-774.

+ Open protocol

+ Expand

RNA Concentration Estimation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA concentrations were estimated using a Bioanalyzer (Agilent Technologies, Les Ulis, France), or Quant‐it™ RiboGreen^® kit (Life Technologies) using 2 μL of eluted RNAs diluted in 100 μL (1/2000 dye TE dilute solution). Fluorescence was measured using a FLUOstar OPTIMA spectrophotometer (BMG Labtech, Champigny sur Marne, France).

Vigneron N., Meryet-Figuière M., Guttin A., Issartel J.P., Lambert B., Briand M., Louis M.H., Vernon M., Lebailly P., Lecluse Y., Joly F., Krieger S., Lheureux S., Clarisse B., Leconte A., Gauduchon P., Poulain L, & Denoyelle C. (2016). Towards a new standardized method for circulating miRNAs profiling in clinical studies: Interest of the exogenous normalization to improve miRNA signature accuracy. Molecular Oncology, 10(7), 981-992.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!