Lightcycler 2.0 system

The MH7A and FLS cells were stimulated by 1 μg/ml LPS and treated with 80 nM BS‐181 for 24 hrs. Total RNA was extracted from MH7A and FLS cells according to the manufacturer's instructions for TRIzol reagent (Invitrogen, CA, USA). Total RNA (500 ng) was used for reverse transcription using PrimeScript RT reagent Kit Perfect Real‐Time kit (Takara Bio Inc., Shiga 525‐0058, Japan). The cDNA was used for quantitative real‐time PCR analysis (qPCR) using SYBR Premix Ex Taq™ (Takara Bio Inc.) and an Roche's capillary‐based Light Cycler 2.0 Systems (Roche Diagnostics Corporation, Indianapolis, IN, USA). Cells cDNA was amplified with specific primers for IL‐1β (sense primer: AACAGGCTGCTCTGGGATTC, antisense primer: AGTCATCCTCATTGCCACTGT), IL‐6 (sense primer: AGTTCCTGCAGAAAAAGGCAAAG, antisense primer: AAAGCTGCGCAGAATGAGATG), IL‐8 (sense primer: ACCGGAAGGAACCATCTCAC, antisense primer: TGGCAAAACTGCACCTTCACAC), RANKL (sense primer: GGAGTTGGCCGCAGACAAGA, antisense primer: ATTAGGATCCATCTGCGCTCTG) and β‐actin (sense primer: ACTCTTCCAGCCTTCCTTC, antisense primer: ATCTCCTTCTGCATCCTGTC) (Invitrogen). Target mRNA was determined using the comparative cycle threshold method of relative quantitation. β‐actin was used as an internal control.

Total RNA was extracted from HCC tissues or xenografts of nude mice or cultured cells according to the manufacturer’s instructions for TRIzol reagent. Total RNA (500 ng) was used for reverse transcription using PrimeScript RT reagent Kit and subjected to quantitative real-time PCR analysis (quantitative PCR, qPCR) using SYBR Premix Ex Taq TM and a Roche’s capillary-based Light Cycler 2.0 Systems. Target mRNA was determined using the comparative cycle threshold method of relative quantification. The calibrator sample was selected from adjacent non-tumor tissues or CON-HepG2 cell samples and β-actin was used as an internal control.

Real-time PCR analysis was performed using the following primers: mouse (m) IL-10 forward: GCCAGAGCCACATGCTCCTA, mIL-10 reverse: GATAAGGCTTGGCAACCCAAGTAA, mouse tumor necrosis factor (mTNF)-alphaforward: TATGGCCCAGACCCTCACA, mTNF-alpha reverse: GGAGTAGACAAGGTACAACCCATC, mIL-6 forward: CCACTTCACAAGTCGGAGGCTTA, mIL-6 reverse: GCAAGTGCATCATCGTTGTTCATAC, mIL1beta forward: TCCAGGATGAGGACATGAGCAC, mIL-1beta reverse: GAACGTCACACACCAGCAGGTTA, mIL-12a forward: CCGGTCCAGCATGTGTCAA, mIL-12a reverse: CAGGTTTCGGGACTGGCTAAGA, mIL-12b forward: ACTCACATCTGCTGCTCCACAAG, mIL-12b reverse: CACGTGAACCGTCCGGAGTA mRplp0 forward: GGCAGCATTTATAACCCTGAAGTG and mRplp0 reverse: TGTACCCATTGATGATGGAGTGTG. Real-time PCR expression profile of cytokines was performed in M-CSF- or GM-CSF-cultured BMCs at day 7 using SYBR Green (TaKaRa, Japan) and LightCycler 2.0 systems (Roche, Basel, Schweiz), and relative quantification analysis was performed with LightCycler Software Version 4.1.

Total RNA was isolated from young and mature leaves of R. tomentosa using a Trizol Kit (Promega, United States). First-strand cDNA was synthesized from 2 μg of purified RNA using HiScript QRT SuperMix for qPCR (Vazyme, Nanjing, China). Two microliter (100 ng μL⁻¹) of cDNA in 20 μL solution systems was used for gene expression performed with SYBR Premix Ex Taq (Takara) on a Roche LightCycler 2.0 system (Roche Applied Science, Branford, CT, United States). The primers of genes were listed in Supplementary Table S8, and the PCR amplification conditions were as follows: 94°C for 5 min; 40 cycles of 95°C for 20 s, 55°C for 20 s, and 72°C for 30 s. For each gene, expression data were normalized with expression level of actin gene and calculated by 2^−ΔΔC_t method. The experiment was carried out three biological and technical replications. The significant differences between samples were statistically evaluated by Student’s t-test method.

Total RNA from tubers and leaves of P. ternata were extracted individually using Trizol Kit (Promega, USA) following the manufacturer's protocol. Subsequently, RNA was treated with 4 × gDNA wiperMix at 42°C for 2 min to remove DNA. The purified RNA (1 ug) was reverse transcribed to cDNA using HiScript QRT SuperMix for qPCR (Vazyme, Nanjing, China). The qPCR reactions were performed in a 20 μl volume composed of 2 μl of cDNA, 0.4 μl of each primer, and 10 μl 2 × SYBR Green Master mix (TaKaRa) in Roche LightCycler 2.0 system (Roche Applied Science, Branford, CT). PCR amplification was performed under the following conditions: 3 min at 94°C, followed by 45 cycles of 94°C for 20 s, 55°C for 20 s, and 72°C for 20 s. Three technical replications were performed for all quantitative PCRs. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was chosen as reference gene control for normalization. The relative changes in gene expression levels were calculated using the 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)). The log2 value of 2^−ΔΔCt was used for representing the relative expressions of each gene. All primers used for the reverse transcription quantitative real-time PCR (RT-qPCR) assay are listed in Data Sheet 1: Table S1.