SGC-7901 cells were treated with Trizol (Sangon, China) according to Trizol’s guidelines. In order to measure mRNA expression levels, RNA was reverse-transcribed into cDNA using Promega’s Reverse Transcription Kit (GoScriptTM Reverse Transcription Kit), followed by qRT-PCR analysis using Biotech’s qRT-PCR reagents (2X SG Fast qPCR Master Mix). As an internal reference, GAPDH was used and 2−ΔΔCt was used to calculate mRNA expression levels.
Trizol
Manufactured by Sangon
Sourced in China
Trizol is a ready-to-use reagent for the isolation of high-quality total RNA from a variety of biological samples, including cells, tissues, and microorganisms. It is designed to effectively lyse samples and maintain the integrity of RNA during the isolation process.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (6 mentions)
Sybr premix ex taq 2, by Takara Bio (5 mentions)
Primescript rt master mix, by Takara Bio (5 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (5 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (4 mentions)
Sybr green, by Takara Bio (4 mentions)
Cw2569, by CoWin Biotech (4 mentions)
Cfx96tm real time system, by Bio-Rad (4 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (4 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (3 mentions)
Hiscript 3 1st strand cdna synthesis kit, by Vazyme (3 mentions)
Goldview staining, by Transgene (3 mentions)
Quantstudio 6 flex real time pcr system 96 well, by Thermo Fisher Scientific (3 mentions)
Quantifast sybr green pcr kit, by Qiagen (3 mentions)
Quantitect reverse transcription kit, by Qiagen (3 mentions)
Dnase, by Thermo Fisher Scientific (3 mentions)
Rna reverse transcription kit, by CWBIO (2 mentions)
Hiscript first strand cdna synthesis kit, by Vazyme (2 mentions)
Abi prism 7500 pcr system, by Vazyme (2 mentions)
100 protocols using trizol
1
Measuring mRNA Levels in SGC-7901 Cells
2
Tissue-specific RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA of tissues (hippocampus and cortex) was extracted with Trizol (Sangon Biotech, Shanghai, China). Total RNA quantity was measured using a BioPhotometer (Eppendorf, Hamburg, Germany). Reverse transcription from 2 µg of RNA was performed using the Hiscript Ⅱ 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). Real-time PCR was performed using Power Syber Green PCR Master Mix (Vazyme, Nanjing, China) and detected by the LightCycler Instrument (Roche Diagnostics, Basel, Switzerland) with software version 1.5.1.62. Results were normalized to the expression of the housekeeping gene Actin. The cycling parameters were as follows: stage 1, 95 °C for 5 min; stage 2, 40 cycles of 95 °C for 10 s and 60 °C for 30 s; stage 3, 95 °C for 15 s, 60 °C for 60 s and 95 °C for 15 s, which were concluded by the melting curve analysis process, and fold changes of gene expression were calculated using the 2−ΔΔCt method. The sequences used in this analysis were as follows: Tnf: forward 5′-CACGCTCTTCTGTCTACTGAACTTC-3′, reverse 5′-GCAGCCTTGTCCCTTGAAGAGAACC-3′; Il1b: forward 5′-GCAACTGTTCCTGAACTC-3′, reverse 5′-CTCGGAGCCTGTAGTGCA-3′; Actb: forward 5′-CATCCGTAAAGACCTCTATGCC-3′, reverse 5′-GACTCATCGTACTCCTGCTTG-3′.
3
Quantitative Analysis of TRIM50 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of TRIM50 mRNA was detected through qPCR. Total RNA from cells was isolated by Trizol (B511311, Sangon Biotech Co., Ltd., Shanghai, China). Subsequently, cDNA was synthesized with RNA reverse-transcription kit (CW2569, CWBIO, Beijing, China) based on the general protocols. Hereafter, qPCR was carried out with SYBR Premix Ex TaqII (RR820A, Takara, Dalian, China) to test the relative expression of TRIM50 mRNA. GAPDH was used as a housekeeping gene. The sequences of the qPCR primers used in this study are displayed in Table 1 .
4
Quantification of IRF4 mRNA Expression in PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from PEMCs was extracted using TRIzol (B511311; Sangon, China) and cDNA was synthesized using a HiScript First Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). RT-PCR was performed using AceQ qPCR SYBR Green Master Mix (Vazyme) on a ABI Prism 7500 PCR System (CA, USA). All primers were purchased from Suchow GENEWIZ Co., Ltd (Suzhou, China), and the reactions were performed in triplicate. The relative level of mRNA was calculated using the -ΔΔCt method, where ΔCt = Ct target gene - Ct reference). The following primer sequences were used: GAPDH F: 5ʹ GAAGGTCGGAGTCAACGGAT 3ʹ, R: 5ʹ CCTGGAAGATGGTGATGGG 3ʹ; IRF4 F: 5ʹ GTGAAAATGGTTGCCAGGTGA 3ʹ, IRF4 R: 5ʹ AGGCTTCGGCAGACCTTATG 3ʹ.
5
Transcriptome Analysis of Iron-Perturbed Toxoplasma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HFF cells infected with tachyzoites were cultured in the medium supplemented with DFO (50 μM) or ammonium iron(II) sulfate (200 μM). After 24 h of incubation, the cells were lysed and the parasites were collected. The collected parasites were washed twice with precooled PBS and resuspended in 1 mL of TRIzol (Sangon Biotech, Shanghai, China). The samples were then flash-frozen in liquid nitrogen and sent to Shanghai Applied Protein Technology Co., Ltd. for transcriptome data analysis (Shanghai, China). Advanced heatmap plots were created using the OmicStudio tool on https://www.omicstudio.cn (accessed on 26 December 2023) [74 (link)].
6
Quantifying gene expression in lung cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from lung tissues using TRIzol (Sangon, Shanghai, China), and from BEAS-2B cells using RNA-easy (Vazmye, Nanjing, China). We prepared cDNA using the HiScript@III RT SuperMix for qPCR (Vazmye, Nanjing, China). Real Time-PCR was performed with 2x Q3 SYBR qPCR Master mix (TOLOBIO, Shanghai, China). We followed the manufacturer’s instructions and calculated the relative change in target gene expression using the 2−△△Ct method. The PCR primer sequences were synthesized by Sangon Biotech Company and are shown in Table1 .
7
Irbesartan and Atorvastatin Effects on Lipid Profiles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Irbesartan was purchased from Jiangsu Hengrui Medicine Co., Ltd. (state approval no. H20000513; Lianyungang, China). Atorvastatin calcium was purchased from Beijing Jialin Pharmaceutical Co., Ltd. (state approval no. H20093819; Beijing, China). TRIzol and RT-PCR kit were purchased from Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). Total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C) kits (all from Cyttel Bioscience Inc., Beijing, China). Skim milk powder (BD Biosciences, San Jose, CA, USA), rabbit anti-rat sPLA2-V polyclonal antibody (cat no. 16009-1-AP; 1:1,000) and goat anti-rabbit-HRP secondary polyclonal antibody (cat. no. SA00001-2; 1:800) were purchased from Wuhan Sanying Biotechnology, Wuhan, China. Protein electrophoresis buffer, transfer membrane buffer and washing, all from Sangon Biotech (Shanghai) Co., Ltd.
8
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (Sangon Biotech, Shanghai, China) and cDNA was reverse-transcribed using PrimeScriptTM RT reagent Kit with gDNA Eraser (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions, respectively. The RT-qPCR was carried out using the PowerUpTM SYBRTM Green Master Mix (Thermo Fisher Scientific, Inc., Waltham, MA, USA) on QuantStudio 1 Real-Time PCR System (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The reaction system: 10 µL 2 × PowerUpTM SYBRTM Green Master Mix, 1 µL cDNA solution, 0.4 µL forward primers (10 µM), 0.4 µL reverse primers (10 µM), 8.2 µL ddH2O. The PCR program was as follows: 50 °C for 2 min, 95 °C for 2 min, 40 cycles at 95 °C for 15 s, 60 °C for 15 s, 72 °C for 30 s. Melting curves were used to verify the amplification specificity via a stepwise heating of the amplicon from 60 to 95 °C at a ramp rate of 0.15 °C s−1. In this study, ZmActin was used as the internal gene. Gene-specific primers are listed in Table 4 . Each extraction and RT-qPCR were replicated three times. The relative expression levels of the target gene were calculated by the 2−△△Ct method.
9
Quantification of ER Stress Markers in HK-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First, we used Trizol (B511311, Sangon, China) to isolate the total RNA of the HK-2 cells. Next, total RNA was dissolved in DEPC water. Thereafter, we used the universal reverse transcription kit (CW2569, ComWin, China) to construct cDNA. Then the cDNA was amplified by SYBR Premix Ex TaqII (RR820A, Takara, Japan) under a PCR instrument (LightCycler® 96, Roche, Switzerland). The amplification conditions were as follows: pre-denaturation at 95 °C for 10 min, denaturation at 95 °C for 15 s, annealing at 60 °C for 1 min, for a total of 40 cycles. The mRNA level of genes was expressed as 2-ΔΔCt [20 (link)]. The primer sequences of the detected genes were shown in Table 1 .
Gene sequence primers
| Gene | Forward primer(5′-3′) | Reverse primer(5′-3′) |
|---|---|---|
| human CHOP | GGAAACAGAGTGGTCATTCCC | CTGCTTGAGCCGTTCATTCTC |
| human GRP78 | CATCACGCCGTCCTATGTCG | CGTCAAAGACCGTGTTCTCG |
| human β-actin | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
10
Quantifying RAGE and eNOS Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by Trizol (Sangon Biotech), and reverse transcribed into cDNA using reverse transcription of DNA (Thermo Fisher Scientific, USA). To quantify the transcriptional degrees of RAGE and eNOS, qRT-PCT was performed on the Prism 7500 Real-time PCR system (Applied Biosystems, Foster City, CA, USA), as described previously [25 (link)]. The primers sequences were as following:
Gene expression was computed by the comparative cycle threshold method.
Gene expression was computed by the comparative cycle threshold method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!