Pcdna3 ha

We generated plasmids encoding various truncated mutants of UCP, pVHL and wild-type UbcH5c for expression in bacterial cells or mammalian cells [9 (link)]. For bacterial expression, plasmids were constructed by ligating PCR products into pET28a (Novagen, WI, USA) and pGEX-4T-1 (GE Healthcare Life Sciences, WI, USA), and for mammalian expression, pFlag-CMV1 (Sigma-Aldrich, MO, USA), pEBG and pcDNA3-HA (Invitrogen, CA, USA) were used. Mutants of UCP and VHL were generated based on the wild-type genes using a PCR method [16 (link)].

HeLa, U2OS, and 293T cells were cultured in Dulbecco’s Modified Eagles Medium supplemented with 10% fetal bovine serum following standard culture conditions and procedures. Human SDE2 and CDT2 cDNA were acquired from Open Biosystems (MHS1010-97228092) and the Dana-Farber/Harvard Cancer Center DNA Resource Core (HsCD00330875), respectively. The full-length or deleted cDNA was PCR-amplified and subcloned into pcDNA3-Flag, pcDNA3-HA (Invitrogen), pEGFP-C1/N1 (Clontech), and pGEX6P-1 (GE Healthcare Life Sciences). Point mutations were introduced using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and confirmed by DNA sequencing. Stable cell lines were generated by retroviral transduction of pMSCV-SDE2-Flag constructs, followed by selection in the presence of 2 μg/mL puromycin.

U2OS and 293T cell lines were acquired from the American Tissue Culture Collection (ATCC). MDA-MB-231 was a kind gift from Jun Chung (Stony Brook Medicine). Cells were cultured in Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin, following standard culture conditions and procedures. FAAP20, FBW7, and GSK3β constructs were previously described [17 (link)]. Plasmids encoding GST-PIN1 was a gift from Michael Yaffe (Addgene plasmid #19027), His-PIN1 from Dustin Maly (Addgene plasmid #40773), V245 pCEP-4HA-B56α from David Virshup (Addgene plasmid #14532), and pBABE-zeo PPP2CA from William Hahn (Addgene plasmid #10689). PIN1 cDNA was subcloned into modified pcDNA3-HA or pMSCV-Flag-HA vectors (Invitrogen). Point or deletion mutations were introduced using the QuikChange II XL Site-Directed Mutagenesis (SDM) kit (Agilent Technologies) and confirmed by DNA sequencing (SBU DNA sequencing facility). Stable cell lines were generated by retroviral transduction of pMSCV-Flag-HA-PIN1 constructs using 8 μg/mL polybrene (Sigma-Aldrich), followed by selection with 2 μg/mL puromycin. Viruses were generated from 293T cells that were co-transfected with pMSCV-Flag-HA-PIN1, pCMV-Gag/Pol and pCMV-VSV-G.

MTMR1 constructs including or lacking the CC domain (95‒665 or 95‒607) were cloned into the p3xFLAG-CMV-10 (Sigma-Aldrich) or pcDNA3-HA (Invitrogen) vectors, respectively. HEK293 cells were cotransfected with FLAG- and influenza hemagglutinin (HA)-tagged MTMR1 expression vectors using polyethylenimine (PEI; Sigma-Aldrich). The cells were harvested 40 hours after transfection. The immunoprecipitation experiment was performed using an anti-FLAG-M2 affinity gel (Sigma-Aldrich). The proteins were separated via 10% sodium dodecyl sulfate-polyacrylamide electrophoresis SDS-PAGE, and the western blot was performed with an anti-HA antibody (Cell Signaling Technology) and an anti-FLAG antibody (Sigma-Aldrich).

Subconfluent HEK293 cells in 24-well tissue culture dishes (Becton Dickinson) were transiently transfected using Metafectene Pro (Biontex) according to the manufacturer's protocol. All wells were cotransfected with 60 ng of luciferase reporter vectors, 100 ng or as indicated in the figures of SPBP expression vector (pDEST-HA-SPBP), 100 ng of CBP expression vector (pHA-CBP), 50 ng or as indicated in the figure of pDEST-HA-NRF2 and 5 ng of a β-galactosidase expression vector. pcDNA₃HA (Invitrogen) was used to equalize the concentration of DNA in each transfection. Extracts were prepared 20 hours post transfection and analyzed essentially as described previously [27] (link). All assays were performed in triplicates and repeated at least three times.

YY1, SET7/9, G9a, MLL1, SET1A, SET1B, SUV4-20H1, SUV4-20H2, ESET, SUV39H1, SUV39H2, DOT1L, SET8, RIZ1, EZH2 full-length (FL) or truncations were PCR-amplified from cDNA samples prepared from HEK293T cells by using KOD Hot Start DNA Polymerase (Novagen) and then cloned into p3XFLAG-CMV-10 (Sigma), pcDNA3-HA (Invitrogen), pEGFP-C3 (Clontech), pET-28a (+) (Novagen) or pGEX-6P-1 (Promega) expression vectors. All point mutations were generated by using QuikChange Lightning Site-Directed Mutagenesis Kit (Stratagene). Luciferase reporter constructs containing YY1 consensus binding motif (CGCTCCCCGGCCATCTTGGCGGCT GGT) or its mutant form (CGCTCCGCGATTATCTTGGCGGCTGGT) were made in pGL2 vector (Promega).