Pacbio sequel 2 platform

A total of 16 RNA samples were equally mixed into a sample pool for the Iso-seq sequencing. The SMARTerTM PCR cDNA Synthesis Kit (Clonetech, USA) was used for the full-length cDNA synthesis. After PCR amplification, purification, and the cDNA fragments (< 1 kb) removal processes, the cDNA products were prepared for the SMRTbell library construction. Then, the purified and qualified library was performed on the PacBio Sequel II platform for third-generation sequencing. The RNA-seq libraries of 16 RNA samples were constructed using a VAHTS Universal V6 RNA-seq Library Prep Kit for MGI (Vazyme, Nanjing, China), and the raw data of RNA-seq was sequenced on the MGISEQ-2000 platform. The library construction and sequencing of Iso-seq and RNA-seq were performed by Frasergen Bioinformatics Co., Ltd. (Wuhan, China).

The isoform sequencing (Iso-Seq) library was prepared according to the isoform sequencing protocol (Iso-Seq) using the Clontech SMARTer^® PCR cDNA Synthesis Kit (Clontech Laboratories (now Takara Laboratories), 634926, Mountain View, CA, USA) and the BluePippin Size Selection System protocol, as described by Pacific Biosciences (PN 100-092-800-03). Briefly, Oligo(dT)-enriched mRNA was reversely transcribed to cDNA by a SMARTer PCR cDNA Synthesis Kit; the synthesized cDNA was then amplified by polymerase chain reaction (PCR) using BluePippin Size-Selection System protocol; the Iso-Seq library was constructed by full-length cDNA damage repair, terminal repair, and attaching SMRT dumbbell adapters; the sequences of the unattached adapters at both ends of the cDNA were removed by exonuclease digestion; the cDNA obtained above was combined with primers and DNA polymerase to form a complete SMRT bell library. While the library was qualified, the PacBio Sequel II platform was used for sequencing based on the effective concentration and data output requirements of the library.

The third-generation sequencing based on PacBio Sequel II platform for globin genes variants detection was conducted as the description of our previous study^{16 (link)}. Genomics DNA were extracted and then sent to Berry Genomics laboratory for third-generation sequencing. Briefly, the purified DNA samples were quantified using the Qubit dsDNA BR assay kit (ThermoFisher Scientific). Then, optimized primers were used to generate specific amplicons that encapsulated known structural variation regions, as well as single nucleotide variations in the HBA1/2 and HBB globin genes, based on databases such as HbVar, Ithanet, LOVD, and LOVD-China. After purification and end repair, double barcode adaptors were ligated to the 5’ and 3’ ends and Sequel Binding and Internal Ctrl Kit 3.0 (PacBio) was used to prepare SMRT bell libraries. Finally, third-generation sequencing was performed on the PacBio Sequel II System after primed DNA-polymerase complexes were loaded onto the SMRT cells^{16 (link)}.
Following alignment of the subreads, the consensus circular sequence was mapped to the GRCh38 reference and variants were called (FreeBayes software, version 1.2.0). Cis- and trans-configuration between two variants in the long reads was analyzed using WhatsHap (version 0.18) software. The alignments of variant and wild-type molecules were visualized using the Integrative Genomics Viewer^{16 (link)}.

Genomic DNA was extracted using the DNA extraction Kit (TGuide S96 Magnetic Universal DNA Kit, TIANGEN) according to the manufacturer’s protocols. Then, the full-length 18S ribosomal RNA gene was amplified by PCR (95°C for 4 min, followed by 35 cycles at 98°C for 15 s, 55°C for 30 s, and 72°C for 2 min, and a final extension at 72°C for 7 min) using barcoded primers Euk-A (AACCTGGTTGA TCCTGCCAGT) and Euk-B (GATCCTTCTGCAGGTTCACCTAC) (Full-length, ∼2,000–2,540 bp) (Countway et al., 2005 (link); Callahan et al., 2019 (link); Liu et al., 2021 (link)). PCR reactions were performed in triplicate 30 μL mixture containing 11.7 μL of nuclease-free water, 15 μL of PCR Mix (KOD OneTM PCR Master Mix, Toyobo), 1.8 μL of each primer (5 μM), and 1.5 μL of template DNA.
Amplicons were extracted from 2% agarose gels and purified using the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich MA, United States) according to the manufacturer’s instructions and quantified using a microplate reader (GeneCompang Limited, synergy HTX). Purified amplicons were pooled in equimolar amounts and sequenced on the PacBio Sequel II platform (PacBio, United States).

We used the PacBio Sequel II platform with single molecular real time (SMRT) sequencing technology and SMRTlink v7.0 software (minLength 50; maxLength 15,000; minPasses 1) to process sequencing samples. After polymer read bases were performed (Chin et al., 2016 (link)), the subreads.bam files were obtained by removing the joint and the original offline data, where the length was less than 50 bp. The circular consensus sequences (CCSs) were obtained using the subreads.bam file through the CCS algorithm, which is self-correcting for single molecule multiple sequencing. Consequently, the full-length-non-chimera (FLNC) and non-full-length (nFL; non-chimera) sequences were identified by determining whether CCSs contained 5′-primer, 3′-primer, and poly-A. FLNC sequences of the same transcript were clustered by a hierarchical n * log (n) algorithm to obtain consensus sequences. The corrected consensus reads were polished from consensus sequences (Arrow polishing) using LoRDEC v0.7 software and the RNA-seq data sequenced by the Illumina HiSeq X Ten platform (Salmela and Rivals, 2014 (link)). Using CD-HIT software (-c 0.95 -T 6 -G 0 -aL 0.00 -aS 0.99), all redundancies were removed in corrected consensus reads to acquire final full-length transcripts and unigenes for subsequent bioinformatics analysis (Fu et al., 2012 (link)).

Highly purified genomic DNA from the isolate FDS-564 was extracted from fungal mycelium grown in a liquid Potato Dextrose Broth for 5 days at room temperature, filtered and freeze-dried before following the modified DNA extraction protocol as previously described (Norgen Biotech Comp., Thorold, Canada). The library was prepared using a SMRT bell Express Template Prep Kit (PacBio, Menlo Park, USA). The library pool was sequenced on one SMRT cell using the PacBio Sequel II platform in the SickKids sequencing facility (Toronto, ON, Canada). The reads were assembled into contigs with the Canu assembler v. 2.1.1 [35 (link)]. The quality of genome assemblies was accessed using QUAST v. 5.0.2 [36 (link)]. The completeness of assembly was estimated with BUSCO v.4.0.5 employing the dataset Ascomycota_odb10 [37 (link)]. Repeat sequences were identified with RepeatMasker v. 4.0.9 [38 ] using the library of repeats for fungi obtained from Repbase [39 (link)]. Gene prediction was executed using Augustus v. 3.4.0 [40 (link)]. Augustus was trained with the gene structures from the representative genome of C. mali 03–8 (GCA_000818155) obtained using the MAKER2 pipeline v. 2.31.11 [41 (link)].