Tb green premix ex taqtm 2

Total cell RNA was extracted with the RNeasy kit (Qiagen) and reverse-transcribed with the PrimeScript RT Master Mix (Takara). qPCR was performed on a Thermal Cycler iQ5 Multicolor Real-Time PCR Detection system (Bio-Rad) using TB Green Premix Ex taqTM II (Takara) and intron-spanning, gene-specific primers as listed below: mouse Hprt (forward: CAGTCCCAGCGTCGTGATTA, reverse: TGGCCTCCCATCTCCTTCAT); mouse Igfbp7 (forward: CTG GTGCCAAGGTGTTCTTGA, reverse: CTCCAGAGTGATCC CTTTTTACC); human HPRT (forward: CTTTGCTGACCT GCTGGATT, reverse: TCCCGTGTTGACTGGTCATT); human IGFBP7 (forward: GCGAGCAAGGTCCTTCCATA, reverse: TCTGAATGGCCAGGTTGTCC). Gene expression was normalized to the house keeping gene HPRT(Hprt).

Total RNA was extracted from the cells exposed to melatonin using Trizol and dispersed in RNase-free water. Then the first cDNA strands were obtained using a PrimeScript^TM RT reagent kit with gDNA Eraser (Takara, Cat# RR047A). Gene-specific primers for amplification were designed using Primer 5 software and shown in Table 2. Real-time quantitative PCR (RT-qPCR) was performed with a Roche LightCycler^® 96 System using TB Green Premix Ex Taq^TM II (Takara, Cat#RR820A). The RT-qPCR protocol was as follows: 95°C for 3 min, followed by 45 cycles of 95°C for 15 s and Tm value for 30 s.

Total RNA was extracted from cells or tissues by the phenol chloroform method using RNAiso (Takara Bio, Inc). Using the PrimeScript RT reagent kit (Takara Bio, Inc), cDNA was synthesized from 1 μg of total RNA after removal of genomic DNA. Random primers were used for reverse transcription reactions other than strand specific. qPCR was performed using Thermal Cycler Dice Real Time System III (Takara Bio, Inc) according to recommended cycling parameters using 1 μl cDNA diluted fivefold with EASY Dilution (Takara Bio, Inc) and TB Green Premix Ex Taq TMII (Takara Bio, Inc). Gene expression levels were normalized to GAPDH by the ΔΔCT method. Primer information for chain-specific RT and primer walking, and for other qRT–PCR, is detailed in Tables S1 and S2, respectively.

Total RNA was extracted as mentioned above. According to the manufacturer's instructions, using the Mir-X miRNA first-Strand Synthesis Kit (Takara, Japan), RNA (2 µg) was converted to cDNA. PCR reaction was performed using TB Green® Premix Ex TaqTM II (Takara, Japan), and U6 was used as the endogenous control. The primers of miR-875-5p and U6 were purchased from RiboBio (RiboBio Co., Ltd, Guangzhou, China), the primer sequences used in this study were as follows; has-miR-875-5p forward:5′-GCGGGCGGTATACCTCAGTTTTAT-3′, reverse 5′-ATCCAGTGCAGGGTCCGAGG-3′; U6 forward: 5′-CTCGCTTCGGCAGCACA-3′; U6 reverse: 5′-AACGCTTCACGAATTTGCGT-3′. 2^−ΔΔCt method was used to calculate the relative expression level. All procedures were also performed in triplicate.

Total RNA was extracted from maize leaves and roots using the EASYspin rapid plant RNA extraction kit (Aidlab, China) following the instructions of the manufacturer. Reverse transcription was performed using a PrimeScript^TM RT reagent kit (TaKaRa, China), and then real-time quantitative RT-PCR was performed on a 7500 fast real-time PCR system (Applied Biosystems, Foster City, CA, United States) using TB Green^® Premix Ex Taq^TM II (Takara, China). A 2^–ΔΔCt-based process was used to quantify relative gene expression level. The Actin gene was chosen as an internal control to normalize the data. Three independent samples were set as biological replicates, and three technical replicates were assayed for each sample. The primers used for real-time qPCR amplification are listed in Supplementary Table S1.

Total RNA was extracted from liver tissue and HepG2 cells using Total RNA kit II (Omega Biotek, Norcross, GA, USA). The PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Kyoto City, Japan) was used to perform the reverse transcription. The expressions of uncoupling protein 1 (Ucp1), peroxisome proliferative activated receptor, gamma, coactivator 1 alpha (Ppargc1a), peptidylprolyl isomerase A (Ppia), acetyl CoA carboxylase (Acc), sterol regulatory element binding transcription factor 1 (Srebf1), fatty acid synthetase (Fasn), stearyl CoA desaturase 1 (Scd1), tumor necrosis factor (Tnf), interleukin 1b (Il 1b), peroxisome proliferator activated receptorα (Ppara), carnitine palmitoyl transferase 1α (Cpt1a), activating transcription factor 4 (Atf4), activating transcription factor 6 (Atf6), DNA-damage inducible transcript 3 (Ddit3), heat shock protein 5 (Hspa5), X-box binding protein 1 (Xbp1) and Xbp1s were detected by using TB Green^® Premix Ex TaqTM II (TaKaRa, Japan) in the ABI7500 PCR system (Applied Biosystems, San Francisco, CA, USA). Ppia and GAPDH were used for the normalization of above target genes. The primers of these gene were listed in Table S1. The 2^−ΔΔCt method was used to calculate the relative expressions of target genes.