RNA from single antigen-specific B cells was reverse transcribed using random hexamers and the SuperScript III kit (Thermo Fisher). Antibody V(D)J genes were amplified from the cDNA by nested PCR, with the HotStar Taq DNA Polymerase kit (Qiagen) using a combination of primer sets and methods described previously39 (link). V(D)J gene assignment, somatic hypermutation and CDR3 determinations were performed using IgBLAST. Antibody variable regions were synthesized and cloned (GenScript) into CMVR expression vectors (NIH AIDS reagent program) between a mouse immunoglobulin leader (GenBank, DQ407610 ) and the constant regions of human IgG1 (GenBank, AAA02914 ), Igκ (GenBank, AKL91145 ) or Igλ (GenBank, AAA02915 ). Antibodies were expressed by co-transfecting plasmids encoding paired heavy and light chains into Expi293F cells (Thermo Fisher). Monoclonal antibodies were purified 4 to 5 d after transfection using AmMag protein-A magnetic beads and the AmMag SA purification system (GenScript), according to the manufacturer’s recommendations, and buffer exchanged into PBS. The purity and stability of mAbs was assessed by SDS–PAGE and Coomassie staining in both reducing and non-reducing conditions. Control antibodies were all expressed as human IgG1 and purified from Expi293F cells, as described above.
Hotstartaq dna polymerase kit
Manufactured by Qiagen
Sourced in Germany, United States, France
The HotstarTaq DNA polymerase kit is a heat-stable DNA polymerase designed for PCR amplification. It exhibits robust and reliable performance across a wide range of templates and applications.
Automatically generated - may contain errors
Lab products found in correlation
Pyromark assay design 2, by Qiagen (9 mentions)
Pyromark vacuum prep workstation, by Qiagen (8 mentions)
Pyromark q96 md pyrosequencer, by Qiagen (6 mentions)
Pyro q cpg software, by Qiagen (6 mentions)
Pyromark q24, by Qiagen (2 mentions)
Pyromark q24 pyrosequencer, by Qiagen (2 mentions)
Qiaamp dna mini kit, by Qiagen (2 mentions)
Ez dna methylation kit, by Zymo Research (2 mentions)
Ammag protein a magnetic beads, by GenScript (1 mentions)
Expi293f cells, by Thermo Fisher Scientific (1 mentions)
Superscript 3 kit, by Thermo Fisher Scientific (1 mentions)
Zymo ez dna methylation kit, by Zymo Research (1 mentions)
Magna grip rack, by Merck Group (1 mentions)
Ovalbumin (ova), by Merck Group (1 mentions)
Salmon sperm dna, by Merck Group (1 mentions)
Dynabead, by Thermo Fisher Scientific (1 mentions)
Abi 3130xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Opticon monitor 3, by Bio-Rad (1 mentions)
Ampliscribe t7 high yield transcription kit, by Illumina (1 mentions)
Omniscript cdna sysnthesis kit, by Qiagen (1 mentions)
37 protocols using hotstartaq dna polymerase kit
1
Cloning and Expression of Monoclonal Antibodies
2
Quantifying DNA Methylation via Bisulfite PCR-Pyrosequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite PCR-pyrosequencing assays were designed with PyroMark Assay Design 2.0 (Qiagen). The regions of interest were amplified by PCR using the HotstarTaq DNA polymerase kit (Qiagen) as follows: 15 min at 95°C (to activate the Taq polymerase), 45 cycles of 30 sec at 95°C, 30 sec at 58°C, and 30 sec at 72°C, and a 72°C 5-min extension step; primer sequences are listed in Supplemental Table 5. For pyrosequencing, a single-stranded DNA was prepared from the PCR product with the Pyromark Vacuum Prep Workstation (Qiagen), and the sequencing was performed using sequencing primers on a Pyromark Q96 MD pyrosequencer (Qiagen). The quantitative levels of methylation for each CpG dinucleotide were calculated with Pyro Q-CpG software (Qiagen). P-values for associations were the asymptotic P-values of the correlations between genotype and average methylation from the pyrosequencing assay. We performed pyrosequencing on the 60 individuals in our pool as well as on 30 additional individuals who are the offspring of those 60.
3
Bisulfite Pyrosequencing of DNA Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from the same samples as above were subjected to bisulfite conversion using the Zymo EZ DNA Methylation Kit (Zymo Research, Irvine, California), which converts DNA methylation information into sequence base differences by deaminating unmethylated cytosines to uracil while leaving methylated cytosines unchanged. Bisulfite pyrosequencing assays were designed with PyroMark Assay Design 2.0 (Qiagen, Hilden, Germany; Supplementary Table 4 ). The regions of interest were amplified by PCR using the HotstarTaq DNA polymerase kit (Qiagen, Hilden, Germany) as follows: 15 min at 95°C, 45 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s, and a 5 min 72°C final extension step. For pyrosequencing, single-stranded DNA was prepared from the PCR product with the Pyromark™ Vacuum Prep Workstation (Qiagen, Hilden, Germany) and the sequencing was performed using sequencing primers on a Pyromark™ Q96 MD pyrosequencer (Qiagen, Hilden, Germany). The quantitative levels of methylation for each CpG dinucleotide were calculated with Pyro Q-CpG software (Qiagen, Hilden, Germany). Of note, only PAE and C animals were assessed by bisulfite pyrosequencing. We selected several DMRs for verification by bisulfite pyrosequencing based on their potential role in PAE-induced deficits, mainly focusing on their associated gene.
4
Detecting TMPRSS2-ERG and AC129492.2-201-ERG Fusion Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Detection of the fusion transcripts TMPRSS2-ERG and AC129492.2-201-ERG was performed with RT-PCR on the previously described cDNA from all samples using the HotStar Taq DNA polymerase Kit (Qiagen) according to the manufacturer’s protocol. Primers were designed using the Primer3 software (Supplementary Table S1 ; http://bioinfo.ut.ee/primer3-0.4.0/ ). Primers were designed to pick up multiple TMPRSS2-ERG fusion transcript variants. Visualization of RT-PCR products with gel electrophoresis was performed with a 2% agarose gel and 200 V for 30 minutes. RT-PCR and UV-visualization were performed at least twice for all samples. For samples with inconclusive results after two rounds of RT-PCR and UV-visualization, an additional RT-PCR reaction and agarose gel was run for verification.
5
ChIP-seq analysis of estrogen receptor transcriptional targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MASE cells were treated with 100 nM E2 for 45 min, then crosslinked with 1% formaldehyde, quenched with 125 mM glycine, and sonicated to produce 150–200 bp fragments. ESR1 antibody (Santa Cruz) or normal mouse Immunoglobin G control (Millipore, USA) were bound to magnetic beads (Dynabeads®; Thermo Fisher Scientific, USA) overnight at 4 °C. Two hundred fifty micrograms of DNA was then pre-cleared with 1 µl/ml salmon sperm DNA (Sigma, USA), 10 µl/ml ovalbumin (Sigma, USA), and 10 µl/ml magnetic beads for 1 h at 4 °C. Ten per cent of pre-cleared chromatin was saved as “input” and DNA was immunoprecipitated with antibody-bound beads overnight at 4 °C. Beads bound by immune-complexes were then collected using a Magna GrIP™ Rack (Millipore, USA) and eluted at 65 °C for 10 min in an Eppendorf Thermomixer. Reverse crosslinking and protease treatment were done on each sample. The immunoprecipitated genomic DNA fragments were isolated with phenol:chloroform:isoamyl alcohol extraction. The HotStarTaq DNA Polymerase Kit (Qiagen, USA) was used to amplify mouse Greb1 ERE1 and ERE2 promoter regions spanning two putative EREs using primers listed in Table S1 .
6
Exogenous IDH1 Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was performed using Qiagen’s HotStarTaq DNA Polymerase kit with primers specific for the exogenous IDH1 (reverse primer binds on junction of exon 4 and 5) or both exogenous and endogenous copies (reverse primer binds within exon 4) (IDH1 DNA forward TTGATCCCCATAAGCATGA, IDH1 DNA and cDNA reverse TCCTGATGAGAAGAGGGTTGA, IDH1 cDNA forward TTGCTCTGTATTGATCCCCATA). The PCR was performed with the following program: denaturation at 95 °C for 15 min followed by 34 cycles of denaturation at 95 °C for 30 s, annealing at 57 °C for 30 s and extension at 72 °C for 45 s. A final elongation step of 72 °C for 10 min was added. The amplicons were run on a 2% agarose gel impregnated with GelRed at 110 V for one hour and photographed under UV light. The amplicons were sequenced using Sanger’s dye terminator method on the ABI 3130xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA).
7
Quantitative RT-PCR Analysis of mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Absolute quantitation of a specific mRNA in samples was determined by RT-qPCR. Ovarian total RNA was reverse transcribed using Omniscript cDNA sysnthesis kit (Qiagen, Valencia, CT) according to manufacturer’s protocol. In vitro transcription of the partial clone of the gene using AmpliScribe™ T7 High Yield Transcription Kit (Epicenter, Madison, WI) was performed to produce gene-specific mRNA containing the qPCR primer and probe sequences, which was reverse transcribed using Omniscript cDNA sysnthesis kit (Qiagen, Valencia, CT) according to manufacturer’s protocol to produce cDNA for standards. Primers for the qPCR were designed to be internal to the cloned region of the gene specific cDNA. Quantitative PCR was performed using BMP2 specific qPCR primers (F: 5′-GACACCAGGTTAGTGAATCAGAACA-3′, R: 5′-TCTTGGAGACACCTGGCTTCTC-3′), β-Actin-specific qPCR primers (F: 5′-TGACCGAGCGTGGCTACAG-3′, R: 5′-CTTCTCTTTGATGTCACGCACAAT-3′) and gene-specific FAM-labeled Taqman probes (BMP2: 6-FAM-5′-TGCTGTGATGCGGTGGACTGCA-3′-BLACKHOLE, β-Actin: 6-FAM-5′-TCACCACCACAGCCGAGAGGGA-3′-BLACKHOLE), cDNA and HotStar Taq DNA polymerase kit (Qiagen, Valencia, CT) following manufacturer’s protocol in a Chromo 4 thermocycler-detector (MJ research, Canada) and analyzed by Opticon monitor 3 (Biorad, Hercules, CA).
8
Bisulfite PCR-Pyrosequencing Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite PCR-pyrosequencing assays were designed with PyroMark Assay Design 2.0 (Qiagen). The regions of interest (IGF2BP2 cg23956648, HOXC6 cg21582112, ZNF492 cg09314196, 6p12.3 enhancer region cg23053977, DOCK1 cg06406458, COL23A1 cg08684511, RORA cg09879458, and ADAM28 cg18757155) were amplified by PCR, using the HotstarTaq DNA polymerase kit (Qiagen) as follows: 15 min at 95 °C (to activate the Taq polymerase), 45 cycles of 95 °C for 30 s, 58 °C for 30 s and 72 °C for 30 s, with a final 5-min extension step at 72 °C. For pyrosequencing, a single-stranded DNA was prepared from the PCR product with the Pyromark Vacuum Prep Workstation (Qiagen), and sequencing was performed with sequencing primers on a Pyromark Q96 MD pyrosequencer (Qiagen). Methylation levels were calculated for each CpG dinucleotide with Pyro Q-CpG software (Qiagen). The primer sequences are listed in Supplementary Table 7 .
9
Quantitative DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite pyrosequencing assays were designed with PyroMark Assay Design 2.0 (Qiagen; Additional file 5 : Table S4). The regions of interest were amplified by PCR using the HotstarTaq DNA polymerase kit (Qiagen) as follows: 15 min at 95 °C, 45 cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s, and a 5 min 72 °C final extension step. For pyrosequencing, single-stranded DNA was prepared from the PCR product with the Pyromark™ Vacuum Prep Workstation (Qiagen), and the sequencing was performed using sequencing primers on a Pyromark™ Q96 MD pyrosequencer (Qiagen). The quantitative levels of methylation for each CpG dinucleotide were calculated with Pyro Q-CpG software (Qiagen).
10
PCR Amplification and Gel Visualization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HotStarTaq DNA Polymerase kit (Qiagen, Hilden, Germany) and 10 mM dNTP (Thermofisher, Dreieich, Germany) were used for all PCRs. PCR amplification was done in a BIO-RAD T100 Thermal Cycler (BIO-RAD, Hercules, CA, USA). Consequently, electrophoresis in 1.5% agarose gel and visualization on UV transilluminator Vilber-Lourmant (Sigma-Aldrich, St. Louis, MO, USA) was used for the detection of PCR products.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!