Abi prism 7000 sequence

The total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA). The total RNA (1 μg) was reverse transcribed using the PrimeScript RT Reagent kit with gDNA Eraser (TaKaRa). The primers are shown in Table 1. The resulting cDNA was diluted, and 5 μl of this dilution was used in 20-μl qPCR mixtures containing 0.8 μl of the primer mixtures, 10 μl of SYBR Premix Ex TaqTM (TaKaRa, Otsu, Shiga, Japan), and 4.2 μl of double-distilled water. RT-PCR was done using the ABI Prism 7000 Sequence detection system (Applied Biosystems, Carlsbad, CA) for 1 cycle at 95°C for 30 s and 40 cycles at 95°C for 5 s and 60°C for 31 s. Dissociation curve analysis was performed to verify product homogeneity. The 16S rRNA amplicon was used as an internal control for data normalization. The changes in transcript level were determined by applying the relative quantitative method (ΔΔC_T). The threshold cycle (C_T) values from all three biological replicates for each strain were compiled. The primers used are listed in Table 1.

Total RNA was isolated from brain cortical tissues of WT and Cln1^−/−mice using the RNA easy Mini Kit (QIAGEN) followed by cDNA synthesis using the Superscript III First-Strand Synthesis kit (Invitrogen) according to the manufacturer's instructions. The levels of mRNA expression was quantified and compared by real-time RT–PCR with SYBR Green PCR mix using ABI Prism 7000 Sequence detection system and analysed by using the ABI Prism Software Version 1.01 (Applied Biosystems). The Ct values were calculated using GAPDH as control. The primers used for V0a1 mRNA are: Forward-5′-CTGTTATCCTCGGCATCATCCAC; Reverse-3′-CAGGTAGCCAAACAACGAGGAC.

RNA extraction was done using Triazol reagent following the guidelines provided (Invitrogen, Carlsbad, CA, USA). A 1 µg aliquot of total RNA was used as template for synthesis of cDNA. The Superscript First Strand Synthesis System for transcripts with high GC content (Invitrogen) was used to synthesize cDNA according to the manufacturer’s instructions. An aliquot of 100 ng of cDNA was used as the template with SYBR Select (Applied Biosystems, Foster City, CA, USA) for quantitative PCR in an ABI Prism 7000 sequence detection system following the manufacturer’s instructions (Applied Biosystems). Normalized primers were specific for the glyceraldehyde phosphate dehydrogenase (GAPDH) gene for quantitative real-time PCR (qPCR). For qPCR, the Cblp gene was used as a control (Schloss, 1990 (link)). The primers used for the respective cDNAs are listed in Supplementary Table S1 at JXB online.

The total RNA was isolated from kidney tissue using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The reverse transcription of the RNA was carried out using M-MLV reverse transcriptase (Invitrogen) according to the manufacturer’s instructions. Beta-actin was used as a housekeeping gene. The PCRs were performed with SYBR Green or TaqMan chemistry using ABI PRISM 7000 sequence detection (Applied Biosystems, Foster City, CA, USA).
The PCRs for ETB and ETA were performed in duplicate in 25 μL final volume containing 1X SYBR Green Master mix (Applied Biosystems) and 300 nM of primers. PCRs for Beta-actin were performed in duplicate in 25 μL final volume containing 1X TaqMan Master mix (Applied Biosystems) and 1X Beta-actin TaqMan Gene Expression Assay (TaqMan assay code Rn00667869_m1, Applied Biosystems). The PCR cycling conditions for the mRNAs were 10 min at +95°C and 40 cycles of 20 s at +95 °C and 1 min at +60 °C. The data were analyzed using the absolute standard curve method [48 (link)]. The expression of Beta-actin did not differ between the groups, allowing its use as a control gene.

Quantitative real-time PCR was performed on an ABI Prism®7000 sequence detection system (Applied Biosystems, Massachusetts, USA) with three technical replicates per sample. Relative quantification of GST and MTC expression was carried out using Platinum® CYBR® Green qPCR SuperMix-UDG with ROX (Invitrogen, Carlsbad, USA). Each reaction was done in a final volume of 10 µL containing 2 µL of ten-fold diluted cDNA and 8 µL of master mix. Cycling conditions were kept constant for all assays. Primers for target and reference genes are listed in table below. The characterization of reaction products was done via melting curve analysis and gel electrophoresis to make sure that no formation of primer-dimer exists. Threshold cycle (C_t) for the gene of interest in both the test samples and control sample were adjusted in relation to a reference gene using the comparative quantification algorithms-ΔC_t (Table 1).Table 1

List of primer used for qPCR

Primer name	Sequence (5′–3′)	Target genes	qPCR efficiency (%)	Amplification factor
MTC_forwardMTC_reverse	AGCCAATATTTTCGAGTGGAGACAAGATGCTCGAATAGCAACAGTA	Metallothionein-like containing protein [20 (link)]	87.50	1.87
GST_forwardGST_reverse	CATCAACATTGCCGACAAACACGACAGCCTTGAACTTTGC	Glutathione S-transferase [22 ]	96.53	1.97
YWHAZ_forwardYWHAZ_reverse	TCGCCCTCAACTTTTCCGTTTGCTATCGCTTCATCGAATGC	Tyrosine 3-monooxygenase [23 (link)]	88.44	1.88