Genomic DNA was isolated from the tail and NSCs of E12.5 embryos using genomic DNA isolation buffer (10 mmol/L Tris‐HCl, pH 8.0, 200 mmol/L NaCl, 10 mmol/L EDTA, 0.5% SDS, and 100 μg/mL Proteinase K [Roche]). Briefly, tails and NSCs were incubated in genomic DNA isolation buffer for 5 hours at 55°C. Next, phenol‐chloroform extraction and ethanol precipitation were performed. The purified genomic DNA was dissolved in TE buffer (10 mmol/L Tris‐HCl, pH 8.0, and 1 mmol/L EDTA), and the mutant Htt gene was amplified. PCR amplification was performed using PrimeSTAR premix (Takara Bio). The following primer sequences were used: forward primer 5′‐CCG CTC AGG TTC TGC TTT TA‐3′ and reverse primer 5′‐TGG AAG GAC TTG AGG GAC TC‐3′ (Figure S1 A).
Primestar premix
Manufactured by Takara Bio
PrimeSTAR premix is a high-fidelity DNA polymerase solution designed for accurate and efficient DNA amplification. It provides a balanced combination of speed, sensitivity, and robustness for a wide range of PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using primestar premix
1
Genomic DNA Extraction and Mutant Htt Gene Amplification
2
Amplification and Sequencing of PG Gene in C. cucumeris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PG gene of C. cucumeris ZYF120413-7 was amplified by PCR based on the sequence of PG gene in 9670T found in NCBI. The forward primer WF1 (TGTCCATTCCGAAGGAATC) and the reverse primer WR2 (AAATCGGCGGTGCAGTCATTCATC) were used for the amplification. The PCR reactions systems were composed of 2 μl WF1 (10 nmol/L), 2 μl WR2 (10 nmol/L), 2 μl template DNA (145.2 ng/μl), 19 μl prime STAR premix (Takara), and 25 μl sterile ddH2O. The PCR procedure was carried out through 5 min of pre-denaturation at 95°C, with 35 cycles of denaturation at 95°C for 20 s, annealing at 55°C for 20 s, extension at 72°C for 30 s, followed by a final extension at 72°C for 10 min. The PCR products were purified by DNA Purification Kit (Tiangen, China) and sequenced by Sangon Biotech Technology Co., Ltd. (China).
3
Huntington's Disease Fibroblast Genomic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Given that the focus of the manuscript is on the experiments performed with the 143 CAG fibroblasts, we will primarily describe these cells. Genomic DNA was, therefore, isolated from hEF and HD143F using genomic DNA isolation buffer (10 mM Tris–HCl, pH 8.0, 200 Mm NaCl, 10 mM EDTA, 0.5 % SDS, 100 µg/ml Proteinase K (Roche), incubated at 55 °C for 3 h, followed by phenol/chloroform extraction and ethanol precipitation. The purified genomic DNA was dissolved in TE buffer (10 mM Tris–HCl, pH 8.0, 1 mM EDTA) and used to amplify the htt gene. PCR amplification was performed in primeSTAR premix (Takara), Pfu HQ buffer (GeneAll) using primers designed to anneal 638 and 1010 bps for hEF and HD143F, respectively. The primer’s sequences were as follows: forward primer (Htt-UTR FW) 5′-ATTGGCAGAGTCCGCAGGCTAG-3′ and reverse primer (Htt intron 1-2 Rev) 5′-GCTGGGTCACTCTGTCTCTG-3′ (Supplemental Fig. 1a). Additional characterizations included the expression of mHtt using EM48, karyotypes and growth curves (Supplemental Fig. 1a).
4
Targeted Genomic Profiling of Tumor Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The specimens from fine-needle biopsy or surgical operations were fixed using formalin and embedded in paraffin. Genomic DNA was isolated from 10 g-paraffin sections using DEXPAT® D9091 Kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions. The target DNA fragment containing mutation loci, including EGFR exon 18, EGFR exon 20, EGFR exon21, KRAS exon2, BRAF exon15, PTEN exon5, PTEN exon6, PTEN exon8, PIK3CA exon9, PIK3CA exon20, was amplified using PCR. The amplification and sequencing primers were designed (Table 1 ) and synthesized by Invitrogen (Shanghai Invitrogen Biotechnology Co., Ltd, Shanghai, China). Primers with AF/AR post-fixed were the amplification primers, and those with SF post-fixed were the sequencing primers. The 25-µL PCR reaction system comprised of 12.5 µL of PrimeStar® Premix (TaKaRa), 2.5 µL of DNA sample, 1.5 µL of 10 µmol/mL AF and AR primers, and 7 µL of ddH2O. The PCR reaction was as follows: an initial denaturation step at 94 °C for 1 min, followed by 35 cycles of denaturation at 94 °C for 10 s, annealing at 58 °C for 5 s, elongation at 72 °C for 15 s, and final extension at 72 °C for 5 min; the products were held at 4 °C. The products were analyzed and identified by 2% agarose gel electrophoresis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!