Qrt pcr

CD34+ and myeloid lineage BM cells (high-density layer) were used for mRNA isolation, using a chloroform extraction protocol, and cDNA synthesis was performed (Takara Bio Inc., Kusatsu, Shiga, Japan) qRT-PCR (Kapa Biosystems, Wilmington, MA, USA) for HIF1A and DDIT4/REDD1 was performed as described in Supplementary Table S2.

Total RNA was isolated from cells, tumors, and adjacent tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, U.S.A.) according to manufacturer’s instructions, and RNA concentration and purity were analyzed in triplicate by Nanodrop 2000 spectrophotometer (Thermo Scientific Inc., Waltham, MA, U.S.A.). After that, the total RNA was reverse transcribed to cDNA using a cDNA Reverse Transcription Kit (Vazyme, Nanjing, China).
To determine the expression level of SNORD31, cDNA sample was tested with quantitative real-time polymerase chain reaction (qRT-PCR) using kits (Roche, Basel, Switzerland). All samples were tested at least three times. The expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous control, and relative expression of SNORD31 was calculated by comparative C_t method formula 2^−ΔΔC_t. The sequences of all PCR primers used were as follows (5′–3′): SNORD31: CACCAGTGATGAGTTGAATTACCG (forward), ACAGCTCAGAAAATACCTTTCAGTC (reverse); GAPDH: CAGGAGGCATTGCTGATGAT (forward), GAAGGCTGGGGCTCATTT (reverse).

To determine the inhibitory effects of natural biological active substance from IO on NO production and pro-inflammatory cytokines expression in inflammatory C2C12 myotubes, C2C12 cells were differentiated with new inhibitor candidate and then induced inflammation using TNF-α. NO production was detected using Griess assay and pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) total RNA expression was analyzed using quantitative RT-PCR (qRT-PCR, Roche, Basel, Switzerland).

Total RNA was isolated from the cartilage layer after thawing and mincing by phenol/guanidine isothiocyanate extraction (peqGOLD Trifast, Peqlab, Germany). For mRNA analysis by quantitative real-time PCR (qRT-PCR), total RNA was purified by Zymoclean™ Gel DNA Recovery Kit according to manufacturer’s instructions and reverse transcribed into cDNA using Omniscript reverse transcriptase (Qiagen, Germany) and oligo(dT) primers. Gene expression was assessed by qRT-PCR (Roche diagnostics, Germany). Depicted percentages of reference genes were calculated as 1.8^−ΔCt as recommended by the manufacturer of the PCR cycler. ΔCt is the difference between Ct values of the gene of interest and the arithmetic mean of the reference genes CPSF6 and HNRPH1. Primer sequences are listed in Additional file 1: Table S1.

The designed oligonucleotides are shown in Table 2. Quantitative real-time-PCR (qRT-PCR; Roche Applied Science, Mannheim, Germany) technology was performed using SYBR Green I on the Light Cycler^® 96 (Roche Applied Science). Primer concentration was optimized to a final concentration of 200 nM and combined with 200 ng of retinal RNAs per well. We set up two reactions per RNA sample (duplicates) with a final volume of 20 μl per single reaction (Ray et al., 2005 (link); Horvat-Brocker et al., 2008 (link); Luft et al., 2014 (link)). Each qRT-PCR was performed in triplicate from each retina and for each point in time and repeated twice. The average threshold cycle (Ct) values of the two independent experiments were used to calculate the ratios for the primers (Pfaffl et al., 2002 (link)). In order to obtain amplification efficiencies of different primer sets, we generated standard curves by a twofold dilution series with template amounts ranging from 5 to 125 ng cDNA per well. The Ct values of the reference genes (β-actin and cyclophilin) were taken into account. For statistical evaluation of Ct variations and calculated relative expression variations, data were analyzed for significant differences by a pairwise fixed reallocation and randomization test using the REST^© software (Qiagen, Hilden, Germany) (Pfaffl et al., 2002 (link)).