Pcrii

To elucidate the spatiotemporal mRNA expression patterns of the zebrafish apolipoproteins, ISH was carried out as previously described (Thisse and Thisse, 2008 (link)). Briefly, ~400–800 base pairs of unique sequence (consisting of coding sequence and in some cases 5′ or 3′ untranslated regions) of apoA-Ia, apoA-Ib, apoBa, apoBb.1, apoBb.2, apoEa, apoEb, apoA-IVa, apoA-IVb.1, apoA-IVb.2 and apoA-IVb.3 were amplified from cDNA (Primers listed in supplementary material Table S2), TOPO^® cloned into pCRII (Invitrogen, Grand Island, NY), and used to generate sense and antisense digoxigenin-labeled riboprobes (digoxigenin was from Roche, Indianapolis, IN). The riboprobes were hybridized against zebrafish of the following stages: eight-cell (to examine the presence of maternal mRNA transcripts), 30% epiboly (blastula), 80–100% epiboly (gastrula), 15–20 somite (somitogenesis), 1 dpf, 2 dpf, 3 dpf, 4 dpf, 5 dpf, and unfed and fed 6 dpf. ISH experiments were carried out three times on n≥5 larvae, for each sense and antisense probe, at each stage.

BAC DNA was mechanically sheared either with nebulizers (for 30 sec) in the TOPO shotgun sub-cloning kit (Invitrogen), or with sonication. Blunt-end fragments were subcloned into pCR4, pCRII (Invitrogen), or pUC118 (Takara Bio). Shearing with sonication, and pUC118 subcloning, were performed by the Kazusa DNA Research Institute. Shotgun subclones were sequenced from both ends by the Research Resource Center (BSI, RIKEN), or the Kazusa DNA Research Institute. Raw sequence data were base-called, vector-trimmed for each, end-clipped to remove low-quality regions, and assembled by CodonCode Aligner (CodonCode: http://www.codoncode.com/aligner/). Assembled contigs were queried against C. reinhardtii V4 protein models, or V. carteri protein models (Ver. 2, JGI and male and female MT, NCBI) using BLASTX to identify protein coding genes (Merchant et al. 2007 (link); Ferris et al. 2010 (link)).

An in-frame deletion allele of rnc was created as follows. The primers of 5outRNase3IFD-KpnI (aaaggtacccaaagagttagcgcatatgacg) and 3outRNase3IFD (cagtatctttagtctgtctttcttgagc) were used to amplify a 2.02 kb DNA fragment including rnc. This amplified fragment was digested and inserted between KpnI and XbaI restriction sites in the multiple cloning site of pCRII (Invitrogen). The KpnI restriction site is located in the primer sequence of 5outRNase3IFD-KpnI, which is underlined, and the XbaI site is located near the 3′ end of the PCR-amplified product. The resulting plasmid was then used as a template in an ‘inside-out’ PCR reaction with the primers of 5inRNase3IFD-XmaI (aaacccgggattagtgagaaaggacctgccc) and 3inRNase3IFD-XmaI (aaacccgggctctgaaataatcaattgtagaacagcg). Restriction of this fragment with XmaI followed by subsequent re-ligation resulted in a nonpolar inframe deletion that replaces DNA sequence encoding Y61 – V181 of RNase III with the sequence of cccggg encoding PG. The in-frame deletion allele of rnc was then inserted between the BamHI and XbaI restriction site in the S. pyogenes-E. coli shuttle vector, pJRS233. The generated plasmid, pJRS233::rnc-IFD, was used to replace the wild type rnc with the in-frame-deleted rnc by a method that employs the temperature sensitivity of the pJRS233 replication origin [31 (link)].