Then WT and MUT sequences of MIAT‐3′UTR and CXCL10‐3′UTR were constructed, followed by endonuclease cleavage of pmiR‐RB‐REPORTTM plasmid (acquired from RiboBio, Guangdong, China). Next, synthesized WT and MUT target gene fragments were inserted into the pmiR‐RB‐REPORTTM vector (RiboBio) with miR‐485‐5p, respectively. Dual‐Luciferase Reporter Assay System (E1910, Promega) was employed for measurement of luciferase activity. Sequence of CXCL10‐3′UTR‐WT was GGAUGGACAGCAGAGAGCCUCCU and that of CXCL10‐3′UTR‐MUT was GGAUGGACAGCAGAGUCGGAGA.
Pmir rb report plasmid
Manufactured by RiboBio
Sourced in China
PmiR-RB-REPORT™ plasmid is a laboratory tool used for the analysis of microRNA (miRNA) activity. The plasmid contains a reporter gene that is regulated by a miRNA-responsive element, allowing for the quantification of miRNA expression levels in cells.
Automatically generated - may contain errors
Lab products found in correlation
Dual luciferase reporter assay system, by Promega (4 mentions)
Pmir rb report vector, by RiboBio (3 mentions)
Spectramax multifunctional microplate reader, by Molecular Devices (2 mentions)
Dual luciferase report analysis system, by Promega (1 mentions)
Veritas luminometer, by Promega (1 mentions)
Dual luciferase reporter assay kit, by Promega (1 mentions)
Dual luciferase assay, by Promega (1 mentions)
Dual luciferase reporter analysis system, by Promega (1 mentions)
Luciferase detection kit, by Beyotime (1 mentions)
Ripa lysis buffer, by Solarbio (1 mentions)
Dual luciferase reporter assay, by Promega (1 mentions)
High fidelity enzyme, by Transgene (1 mentions)
13 protocols using pmir rb report plasmid
1
Cloning and Luciferase Assay of CXCL10 3'UTR
2
Luciferase Assay for DANCR and AKT2 Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The target site sequence (WT) and the sequence (MUT) after targeted mutation of the WT target site of DANCR and AKT2 mRNA 3′-UTR region were synthesized. Restriction enzymes were adopted to digest pmiR-RB-REPORTTM plasmid (RiboBio, Guangzhou, China), and the artificially synthesized target gene fragments WT and MUT were inserted into pmiR-RB-REPORTTM vector, respectively. The luciferase reporter plasmids WT and MUT that were sequenced correctly were used for subsequent transfection. The vectors containing MUT and WT were co-transfected into HEK293T cells with mimic-NC or miR-194 mimic, respectively. After 48 h of transfection, the cells were collected and lysed. The Renilla luciferase detection kit (YDJ2714, Shanghai Yuduo Biological Technology) was used to determine relative luciferase unit. With firefly luciferase as an internal reference, luciferase activities were analyzed using a dual luciferase report analysis system (Promega Co, Madison, WI).
3
Validation of miR-107 Target Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The target gene of miR-107 was predicted with prediction websites TargetScan version 7.1 (http:// www.targetscan.org/ vert_71, last accessed December 19, 2018) and LncTBD version 2.0 (http://www.bio-bigdata.net/LncACTdb, last accessed December 19, 2018). Subsequently, a dualluciferase reporter gene assay was conducted to examine whether LINC00467 and KIF23 were the direct targets of miR-107. The wide-type (WT) target site sequence and mutant-type (MUT) sequence obtained from site-specific mutagenesis on WT of LINC00467 and the 3 0 untranslated region of KIF23 mRNA were synthesized. pmiR-RB-REPORTTM plasmid (RiboBio Company, Guangzhou, China) was enzymatically digested using restrictive endonuclease. Synthesized target gene segments (WT and MUT) were then inserted into the pmiR-RB-REPORT vectors (RiboBio Company) with miR-107 mimic. Simultaneously, empty plasmid transfection was regarded as the control group. Firefly and Renilla luciferase activities were determined at the 48-hour time interval after transfection using a luciferase detection reagent kit (RG005; Beyotime Biotechnology Co). Results were expressed as follows: the relative luciferase activity Z relative luciferase units of firefly luciferase/relative luciferase units of Renilla luciferase. 20
4
Nogo-C 3'UTR Luciferase Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nogo-C 3′-UTR sequences were amplified by PCR with primers: 5′-GCGCTCGAGAAAAGC CCCAAACAGAAGT-3′ (forward) and 5′-AATGCGGCCGCAAACACTAAACACAAACAT-3′ (reverse). PCR products were then constructed into pmiR-RB-REPORT plasmid (Guangzhou RiboBio) containing two reporters, a renilla luciferase (hRluc) for expression evaluation, and a firefly luciferase (hluc) as an internal control for amount correlation. Hela cells were co-transfected with 100 ng Nogo-C 3′UTR reporter plasmid and 2 μg rno-miR-182 mimic or empty vector. Cells were collected 48 h after transfection and analyzed using a Dual Luciferase Reporter Assay System (Promega, Madison, WI, USA). Luciferase activity was examined by Veritas luminometer (Turner BioSystems, Sunnyvale, CA, USA). Renilla luciferase activity of each sample was normalized to firefly luciferase activity.
5
Validating miR-16 Binding to CIAPIN1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The potential targets of miR-16 were predicted using the TargetScan website (http://www.targetscan.org/vert_72/ ). CIAPIN1 was predicted as a target of miR-16. In order to confirm that miR-16 directly bound to CIAPIN1, a dual-luciferase reporter gene assay was performed. The 3′-UTR of CIAPIN1 containing the miR-16-binding sites (CIAPIN1-WT) and 3′-UTR of CIAPIN1 containing the mutant miR-16-binding sites (CIAPIN1-Mut) were synthesized. The CIAPIN1-WT and CIAPIN1-Mut were cloned into pmiR-RB-REPORT™ plasmid (Guangzhou RiboBio Co., Ltd.). Each recombinant vector, pmiR-CIAPIN1-WT or pmiR-CIAPIN1-Mut, along with miR-16 mimics or miR-16 mimics NC, were co-transfected into the H9c2 cells using Lipofectamine™ 3000 reagent, according to the manufacturer's protocol. After 48 h of transfection, the total protein was extracted, and the luciferase activity was detected using a Dual-Luciferase Reporter assay kit (Promega Corporation, Madison, WI, USA), according to the manufacturer's protocol. The activity of Renilla luciferase was used for normalization.
6
Regulation of CHL1 3'UTR by miR-338-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild and mutant type 3ʹ UTRs (untranslated regions) of CHL1 were synthesized and cloned into pmiR-RB-Report plasmid (RIBOBIO, Guangzhou, China). The plasmids were transfected into A549 cells and SK-MES-1 cells with miR‐338‐3p-mimics or NC (negative control). A total of 100 μl 1× PLB was added to per well to harvest the cell lysis buffer. The Dual Luciferase Assay (Promega E1910, China) was applied to analyze the luciferase activity in 48 h after transfection. The experiment was repeated three times independently.
7
Validation of miR-148a-3p binding site in ERRFI1 3'UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After site-directed mutagenesis in core sequence (5′-TGCACTGA-3′) of the ERRFI1 mRNA 3′-untranslated regions (3′-UTR) where a putative miR-148a-3p binding site existed, the ERRFI1-3′-UTR-mutant (MUT) sequence was generated. The pmiR-RB-REPORT plasmid (RiboBio Co., Ltd., Guangzhou, China) was subsequently cleaved with restriction enzymes and then, the target sequence of the artificially synthesized wild type (WT) and MUT were inserted into the pmiR-RB-REPORT vector (RiboBio Co., Ltd., Guangzhou, China), respectively. The recombinant WT and MUT luciferase reporter plasmids were sequenced prior to transfection. The vectors containing MUT and WT were co-transfected with mimic-NC or miR-148a-3p mimic into HEK293T cells, respectively. After 48 h of transfection, the cells were collected, lysed and centrifuged for 3–5 min to collect the supernatant. A Renilla luciferase detection kit (YDJ2714, Shanghai Yuduo Biotechnology Co., Ltd., Shanghai, China) was applied to determine the relative luciferase units (RLU), where firefly luciferase was regarded as an internal control. A dual-luciferase reporter analysis system (Promega Co, Madison, WI, USA) was employed for data analysis. Each experiment was repeated 3 times independently.
8
Rspo3 3'-UTR Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild-type (WT) or mutant (MUT) 3′-UTR of the Rspo3 sequence was cloned into the pmiR-RB-REPORT™ plasmid (Guangzhou RiboBio Co., Ltd., Guangzhou, China). After incubation for 48 h, the cells were collected, and the firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega Corporation, Madison, WI, USA). The firefly luciferase activity was normalized to the Renilla luciferase activity. The luciferase efficiency was evaluated 2 min after the addition of the Stop & Glo® reagent using a SpectraMAX Multifunctional Microplate Reader (Molecular Devices, USA).
9
Regulation of PD-L1 by let-7 and circRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The online starBase software (http://starbase.sysu.edu.cn/ ) was used to predict the binding sites of let-7 miRNA with wild type circ-CPA4 (Wt-circ-CPA4) and 3′ untranslated regions of PD-L1 mRNA (Wt-PD-L1), respectively. The targeting sites were mutated in circ-CPA4 (Mut-circ-CPA4) and PD-L1 mRNA (Mut-PD-L1), and the above sequences were cloned into a PmiR-RB-REPORT™ plasmid (RiboBio, Guangdong, China) to generate reporter vectors. The above vectors were co-transfected with let-7 miRNA mimic and inhibitor into NSCLC cells, respectively. A luciferase detection kit (Beyotime, Shanghai, China) was used to detect the relative luciferase activity in cells.
10
Rspo3 3'UTR Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild-type (WT) or mutant-type (MUT) of the 3'UTR of Rspo3 sequences was cloned into the pmiR-RB-REPORT™ plasmid (Guangzhou RiboBio Co., Ltd., Guangzhou, China). After incubation for 48 h, the cells were collected and re y and Renilla luciferase activity were was measured using the Dual-Luciferase Reporter Assay system (Promega Corporation, Madison, WI, USA). Fire y luciferase activity was normalized to Renilla luciferase activity. The luciferase e ciency was evaluated at 2 min following Stop & Glo® reagent using SpectraMAX Multifunctional Microplate Reader (Molecular Devices).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!