Log In Sign up
The largest database of trusted experimental protocols

Pmcherry c1

Manufactured by Takara Bio
Visit Supplier
Sourced in United States, Japan

PmCherry-C1 is a fluorescent protein-based reporter vector designed for expression and imaging in mammalian cells. It contains the PmCherry fluorescent protein gene under the control of a cytomegalovirus (CMV) promoter.

Automatically generated - may contain errors

Lab products found in correlation

Pegfp c1, by Takara Bio (18 mentions) Pegfp n1, by Takara Bio (10 mentions) Pecfp c1, by Takara Bio (6 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (6 mentions) Pcdna3, by Thermo Fisher Scientific (5 mentions) Peyfp c1, by Takara Bio (4 mentions) Cytochrome c gfp, by Addgene (4 mentions) Pegfp c3, by Takara Bio (3 mentions) Pmetluc2 control, by Takara Bio (3 mentions) Aav pgk cre, by Addgene (3 mentions) Pcl ctig, by Addgene (2 mentions) Prk1043, by Addgene (2 mentions) Pbi mcs egfp, by Addgene (2 mentions) Aav flex rev chr2 tdtomato, by Addgene (2 mentions) Yfp fkbp, by Addgene (2 mentions) Xp rabbit mab, by Cell Signaling Technology (2 mentions) Cortactin, by Abcam (2 mentions) Pegfp n3, by Takara Bio (2 mentions) Jetprime reagent, by Polyplus Transfection (2 mentions) Pecfp n1, by Takara Bio (2 mentions)

Close spelling variants of this product

PmCherry-C1 vector (43 citations) PmCherry (18 citations) PmCherry-C1 plasmid (7 citations) PmCherry-C1 expression vector (4 citations) MCherry gene cassette of pmCherry‐C1 (2 citations) PmCherry-C1 mammalian expression vector (2 citations)

92 protocols using pmcherry c1

1

Cloning and Characterization of Human COPII Proteins

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
All reagents were purchased from Sigma-Aldrich unless otherwise stated. Human Sec24B was subcloned into pmCherry-C1 (Clontech) using SalI and BglII restriction sites and verified by sequencing. Human Sec24C was subcloned into pmCherry-C1 or pEYFP-C1 (Clontech) using XhoI and SacII restriction sites and verified by sequencing. Human Rab1B was cloned into pEGFP-C1 (Clontech) using XhoI and BamHI restriction sites and verified by sequencing. ss-mCherry (mCherry with the signal sequence from hen-egg-lysozyme). YFP-VSVGtsO45 was prepared as described elsewhere (Ward et al., 2001 (link)). GalT-YFP was prepared as described elsewhere (Zaal et al., 1999 (link)). GFP-CFTR and CFTRΔ508-GFP were a kind gift from R. Kopito (Stanford University, Stanford, CA). Rab1b was prepared as described elsewhere (Nevo-Yassaf et al., 2012 (link)). Reticulon-GFP was a kind gift from T. Rapoport (Harvard University, Boston, MA). Carboxypeptidase E was a kind gift from R. Harbesfeld (TAU, Tel-Aviv, Israel). Sec24B V932R mutant was prepared using the Quick-Change kit from Stratagene. The primer used for the PCR reaction was 5′-CAA​GAA​AAA​TTG​GGT​TTG​AAG​CTA​GAA​TGA​GAA​TAA​GGT​GTA​CTA​AAG​G-3′.
Shomron O., Nevo-Yassaf I., Aviad T., Yaffe Y., Zahavi E.E., Dukhovny A., Perlson E., Brodsky I., Yeheskel A., Pasmanik-Chor M., Mironov A., Beznoussenko G.V., Mironov A.A., Sklan E.H., Patterson G.H., Yonemura Y., Sannai M., Kaether C, & Hirschberg K. (2021). COPII collar defines the boundary between ER and ER exit site and does not coat cargo containers. The Journal of Cell Biology, 220(6), e201907224.
+ Open protocol
+ Expand
2

Plasmid Transfection Experiments

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmid used in transfection experiments included: pLAMP1-RFP (Addgene plasmid #1817, gift from Walther Mothes), pmCherry-C1 (Clontech) and peGFP-C3 vector (Clontech). To generate mCherry-tagged αII-spectrin (pmCherry-αIISp), the cDNA sequence of human αII-spectrin (NM_001130438.3) was amplified by PCR as a BsrGI/XhoI fragment and cloned into the corresponding sites of pmCherry-C1 (Clontech). peGFP-C3-Y1874A-βII-spectrin and HA-tagged 220 kDa ankyrin-B (pAnkB-3xHA) plasmids were previously reported26 (link). All plasmids were verified by full-length sequencing prior to transfection.
Cousin M.A., Creighton B.A., Breau K.A., Spillmann R.C., Torti E., Dontu S., Tripathi S., Ajit D., Edwards R.J., Afriyie S., Bay J.C., Harper K.M., Beltran A.A., Munoz L.J., Rodriguez L.F., Stankewich M.C., Person R.E., Si Y., Normand E.A., Blevins A., May A.S., Bier L., Aggarwal V., Mancini G.M., van Slegtenhorst M.A., Cremer K., Becker J., Engels H., Aretz S., MacKenzie J.J., Brilstra E., van Gassen K.L., van Jaarsveld R.H., Oegema R., Parsons G.M., Mark P., Helbig I., McKeown S.E., Stratton R., Cogne B., Isidor B., Cacheiro P., Smedley D., Firth H.V., Bierhals T., Kloth K., Weiss D., Fairley C., Shieh J.T., Kritzer A., Jayakar P., Kurtz-Nelson E., Bernier R.A., Wang T., Eichler E.E., van de Laar I.M., McConkie-Rosell A., McDonald M.T., Kemppainen J., Lanpher B.C., Schultz-Rogers L.E., Gunderson L.B., Pichurin P.N., Yoon G., Zech M., Jech R., Winkelmann J., Beltran A.S., Zimmermann M.T., Temple B., Moy S.S., Klee E.W., Tan Q.K, & Lorenzo D.N. (2021). Pathogenic SPTBN1 variants cause an autosomal dominant neurodevelopmental syndrome. Nature genetics, 53(7), 1006-1021.
+ Open protocol
+ Expand
3

Plasmid Transfection Experiments

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmid used in transfection experiments included: pLAMP1-RFP (Addgene plasmid #1817, gift from Walther Mothes), pmCherry-C1 (Clontech) and peGFP-C3 vector (Clontech). To generate mCherry-tagged αII-spectrin (pmCherry-αIISp), the cDNA sequence of human αII-spectrin (NM_001130438.3) was amplified by PCR as a BsrGI/XhoI fragment and cloned into the corresponding sites of pmCherry-C1 (Clontech). peGFP-C3-Y1874A-βII-spectrin and HA-tagged 220 kDa ankyrin-B (pAnkB-3xHA) plasmids were previously reported26 (link). All plasmids were verified by full-length sequencing prior to transfection.
Cousin M.A., Creighton B.A., Breau K.A., Spillmann R.C., Torti E., Dontu S., Tripathi S., Ajit D., Edwards R.J., Afriyie S., Bay J.C., Harper K.M., Beltran A.A., Munoz L.J., Rodriguez L.F., Stankewich M.C., Person R.E., Si Y., Normand E.A., Blevins A., May A.S., Bier L., Aggarwal V., Mancini G.M., van Slegtenhorst M.A., Cremer K., Becker J., Engels H., Aretz S., MacKenzie J.J., Brilstra E., van Gassen K.L., van Jaarsveld R.H., Oegema R., Parsons G.M., Mark P., Helbig I., McKeown S.E., Stratton R., Cogne B., Isidor B., Cacheiro P., Smedley D., Firth H.V., Bierhals T., Kloth K., Weiss D., Fairley C., Shieh J.T., Kritzer A., Jayakar P., Kurtz-Nelson E., Bernier R.A., Wang T., Eichler E.E., van de Laar I.M., McConkie-Rosell A., McDonald M.T., Kemppainen J., Lanpher B.C., Schultz-Rogers L.E., Gunderson L.B., Pichurin P.N., Yoon G., Zech M., Jech R., Winkelmann J., Beltran A.S., Zimmermann M.T., Temple B., Moy S.S., Klee E.W., Tan Q.K, & Lorenzo D.N. (2021). Pathogenic SPTBN1 variants cause an autosomal dominant neurodevelopmental syndrome. Nature genetics, 53(7), 1006-1021.
+ Open protocol
+ Expand
4

Characterization of DPR and TDP-43 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
We previously generated and characterised expression of DPR constructs for expression of GA1020, GR1136, PR1100 and AP1024 under the CMV promoter and with a C-terminal GFP-tag, using the pEGFP-N1 vector8 . To overcome the potential issue of repeat-length instability between preparations of plasmid, each individual tube of DPR construct was size-screened before use by restriction digest and agarose gel as described previously, to ensure repeat-length was correct8 . Empty pEGFP-N1 vector was used throughout as a GFP-only control. A full length TDP-43 clone (a gift from Professor Leonard Petrucelli, Mayo Clinic, Florida, USA) was used as a template for PCR using the forward primer (5′ GCTCAAGCTTATATGTCTGAATATATTCGGGTA 3′) and reverse (5′ GAGCGGATCCCTACATTCCCCAGCCAGAAGACT 3′) containing HindIII and BamHI sites respectively. After digestion the product was ligated in pmCherry-C1 (Clontech) in the same restriction sites to create the pmCherry-C1 TDP-43 WT construct. All constructs were verified by DNA sequencing.
Ryan S., Rollinson S., Hobbs E, & Pickering-Brown S. (2022). C9orf72 dipeptides disrupt the nucleocytoplasmic transport machinery and cause TDP-43 mislocalisation to the cytoplasm. Scientific Reports, 12, 4799.
+ Open protocol
+ Expand
5

CFTR Protein Structure FRET Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Δ264CFTR was subcloned from pcDNA3.1 into pmCherry-C1 (Clontech, #632524) using the following primers: 5’-tagggtaccatgatcgagaacatccaatctgtta-3’ and 5’- taaacgggccctaaagccttgtatcttgca-3’. Δ27–264CFTR was subcloned from pcDNA3.1 into pmCherry-C1 (Clontech, #632524), and ΔF508-CFTR was subcloned from pcDNA3.1 into pAcGFP1-C1 (Clontech, #632470) using the following primers: 5’-ctaggtaccatgcagaggtcgcctctggaaaat-3’ and 5’-taaacgggccctaaagccttgtatcttgca-3’. The GFP/mCherry (donor/acceptor) pair was used for acceptor photobleach FRET. Images for GFP and mCherry were collected before and after photobleaching with the 594-nm argon/2 laser at the maximum intensity. From the images, the signal intensity of GFP was measured with Zeiss image software, and FRET efficiency was calculated using the following formula: FRETefficiecy=(Ipost-IpreIpre) , where Ipre and Ipost correspond to the GFP signal intensity (with background signal subtracted) before and after photobleach, respectively. Note that FRET between Δ27-264 and ΔF508 does occur within the ER region.
Bergbower E.A., Sabirzhanova I., Boinot C., Guggino W.B, & Cebotaru L. (2019). RESTORATION OF F508-DEL FUNCTION BY TRANSCOMPLEMENTATION: THE PARTNERS MEET IN THE ENDOPLASMIC RETICULUM. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 52(6), 1267-1279.
+ Open protocol
+ Expand
6

Plasmid Construction for EGFP-2B Study

Check if the same lab product or an alternative is used in the 5 most similar protocols
pmCherry-C1 (Clontech) was a kind gift from Prof. Wenhui Li, Beijing life science Institute, Beijing, China. pmCherry-LC3 was constructed based on pmCherry-C1. pcDNA3.1(+) was kindly provided by Prof. Hong Ling, Department of Microbiology, Harbin Medical University, Harbin, China. Plasmids expressing the of EGFP-2B and EGFP-2B truncated were constructed based on pcDNA3.1(+). Plasmids expressing EGFP-2B mutants were constructed based on pEGFP-2B by site-directed mutagenesis and overlapping polymerase chain reaction (PCR). Sequence analysis of the constructs was performed by Genewiz (Beijing, China). PCR primers were obtained from TaKaRa.
Wu H., Zhai X., Chen Y., Wang R., Lin L., Chen S., Wang T., Zhong X., Wu X., Wang Y., Zhang F., Zhao W, & Zhong Z. (2016). Protein 2B of Coxsackievirus B3 Induces Autophagy Relying on Its Transmembrane Hydrophobic Sequences. Viruses, 8(5), 131.
+ Open protocol
+ Expand
7

Engineered MESA Fusion Protein Assembly

Check if the same lab product or an alternative is used in the 5 most similar protocols
Constructs encoding MESA fusion proteins were assembled by PCR amplification and standard molecular cloning. MESA constructs were cloned into the adeno-associated virus expression vector plasmid pAAV GFP SN48 , 49 (link), although expression was achieved by transient transfection (not viral packaging). pDSRedExpress2 was included as a transfection control. Source plasmids for MESA components included: pCL-CTIG (Addgene plasmid 14901)50 (link), pRK1043 (Addgene plasmid 8835)28 (link), pBI-MCS-EGFP (Addgene plasmid 16542)31 (link), pBS mCD4 (Addgene plasmid 14613)51 (link), AAV-FLEX-rev-ChR2-tdtomato (Addgene plasmid 18917)52 (link), pEBFP2-Nuc (Addgene plasmid 14893)53 (link), YFP-FKBP (Addgene plasmid 20175)54 (link) and YFP-tagged FRB (YR) (Addgene plasmid 20148)54 (link), pmCherry-C1 (Clontech 632524)27 (link). A complete list of DNA constructs as well as plasmids and primers used for cloning can be found in Supporting Information.
Daringer N.M., Dudek R.M., Schwarz K.A, & Leonard J.N. (2014). Modular Extracellular Sensor Architecture for Engineering Mammalian Cell-based Devices. ACS Synthetic Biology, 3(12), 892-902.
+ Open protocol
+ Expand
8

Optogenetic Control of Cofilin Dynamics

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies were from the following sources: Cofilin (D3F9) XP® Rabbit mAb (Cell Signaling #5175), β-Actin (8H10D10) Mouse mAb (Cell Signaling #3700), Tks5 (Santa Cruz Biotechnology; sc-30122), Cortactin (Abcam; ab33333). The cDNA of the LOV2 domain from Avena sativa (oat) Phototropin1 (L404-L547) was used to generate photo-sensitive constructs. Three variants of LOV2 were used: wild-type, dark state mutant (C450A, L514K, G528A, L531E, and N538E), and lit state mutant (I510E/I539E) (Supplementary Table 2). 24 (link) The cDNA of full-length rat cofilin was used for all constructs. The Z affibodies that selectively bind dark state LOV2 have been described elsewhere. 24 (link) For transient expression in mammalian cells, constructs were cloned into pmCherry-C1 (Clontech Laboratories, Inc.). Cells were transfected with Lipofectamine 2000 (Life Technologies) using the manufacturer’s protocol 24 h before imaging. For imaging of living cells, cells were co-transfected with mCherry Z-lock cofilin and a membrane-anchored yPet (KRas C-terminus) to visualize the cell edge. 51
Stone O.J., Pankow N., Liu B., Sharma V.P., Eddy R.J., Wang H., Putz A.T., Teets F.D., Kuhlman B., Condeelis J.S, & Hahn K.M. (2019). Optogenetic control of Cofilin and αTAT in living cells using Z-lock. Nature chemical biology, 15(12), 1183-1190.
+ Open protocol
+ Expand
9

Plasmid Acquisition and Modification Protocols

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The DNA plasmid of pmCherry-C1 and pEGFP-actin was purchased from Clontech Laboratories Inc., Mountain View, CA, USA. The mCherry-PMCA4b plasmid was generated as described previously [31 (link)]. The trafficking mutant pEGFP-PMCA4b-L1167-1169A construct was prepared previously [31 (link)]. The SB-CAG-GFP-PMCA4b-CAG-Puromycin and SB-CAG-GFP-PMCA4b-LA-Puromycin constructs were generated, as described [26 (link)]. The non-functional mutant mCherry-PMCA4b-DE was created by introducing the D672E point mutation into the mCherry-PMCA4b and GFP-PMCA4b plasmids using QuikChange II Site-Directed Mutagenesis Kit (Stratagene) as described previously [32 (link)]. pCAGGS-GCaMP2-actin was a gift from Karel Svoboda (Addgene plasmid # 18928; http://n2t.net/addgene:18928; Accessed date: January 2021; RRID: Addgene_18928) [33 (link)]. The Cofilin-pmCherryC1 was a gift from Christien Merrifield (Addgene plasmid # 27687; http://n2t.net/addgene:27687; Accessed date: January 2021; RRID: Addgene_27687) [34 (link)] and CMV-R-GECO1 was a gift from Robert Campbell (Addgene plasmid # 32444; http://n2t.net/addgene:32444; Accessed date: January 2021; RRID: Addgene_32444) [35 (link)].
Naffa R., Padányi R., Ignácz A., Hegyi Z., Jezsó B., Tóth S., Varga K., Homolya L., Hegedűs L., Schlett K, & Enyedi A. (2021). The Plasma Membrane Ca2+ Pump PMCA4b Regulates Melanoma Cell Migration through Remodeling of the Actin Cytoskeleton. Cancers, 13(6), 1354.
+ Open protocol
+ Expand
10

Generation and Characterization of Fluorescent Fusion Constructs

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
GFP-TRPML1, GFP-TRPML1-7Q, Lamp1-GFP, and Lamp1-mCherry constructs were generated as described previously33 (link). Dominant-negative Kif5B (human Kif5B a.a. residues 592-963) was subcloned to pmCherry-C1 (Clontech) using Kif5B cDNA as the template. Dominant-negative dynein intermediate chain 2 (GFP-DYNIC2-DN) and GFP-dynamitin (both were gifts from Dr. Kristen Verhey at the University of Michigan) have been characterized previously47 (link),67 (link). mCherry-ALG2 and GFP-TRPML1-R44LK-AAA were provided by Dr. Rosa Puertollano (NHLBI, NIH). mCherry-ALG2-E47E114-AA, GFP-TRPML1-R44-A, GFP-TRPML1-L45-A, Rab7-T22N-GFP, Rab7-Q67L-GFP mutants were generated with a site-directed mutagenesis kit. All constructs were verified with sequencing and confirmed with western blotting.
Li X., Rydzewski N., Hider A., Zhang X., Yang J., Wang W., Gao Q., Cheng X, & Xu H. (2016). A Molecular Mechanism to Regulate Lysosome Motility for Lysosome Positioning and Tubulation. Nature cell biology, 18(4), 404-417.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!