Cdna synthesis kit

Manufactured by Meridian Bioscience

Sourced in United Kingdom, United States, Australia

The cDNA Synthesis Kit is a laboratory instrument designed to synthesize complementary DNA (cDNA) from RNA samples. The kit provides the necessary reagents and protocols to convert RNA into a stable cDNA format, which can then be used for various downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Bioline Tetro cDNA synthesis kit First strand cDNA synthesis kit Tetro Reverse Transcriptase cDNA synthesis kit Tetro cDNA Strand cDNA Synthesis Kit SensiFAST cDNA Synthesis Kit for RT-qPCR SentiFAST cDNA synthesis kit SensiFAST cDNA Synthesis Kit Bioscript cDNA synthesis kit IScript cDNA synthesis kit Bioline SensiFAST cDNA synthesis kit

24 protocols using cdna synthesis kit

Quantifying Gene Expression in Hypoxia

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation was performed using Trizol (Sigma) and an RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a cDNA synthesis kit (Bioline) according to manufacturer’s protocol. Gene expression was analysed using TaqMan probe sets (Applied Biosystems) details of the TaqMan assays used can be found in Table 2. QPCR was performed on a StepOnePlus instrument (Applied Biosystems) to obtain comparative ΔΔCt values. Data was normalized to the non-hypoxia responsive housekeeping gene RPLP0.Table 2

TaqMan gene expression assay details.

Gene	TaqMan Assay Number
RPLP0	Mm00725448_s1
PTHrP	Mm00436057_m1
MEF2C	Mm01340842_m1
RUNX2	Mm00501584 m1
Col10a1	Mm00487041_m1

Browe D.C., Coleman C.M., Barry F.P, & Elliman S.J. (2019). Hypoxia Activates the PTHrP –MEF2C Pathway to Attenuate Hypertrophy in Mesenchymal Stem Cell Derived Cartilage. Scientific Reports, 9, 13274.

+ Open protocol

+ Expand

Catechin Extract Enhances Glucose Uptake

Check if the same lab product or an alternative is used in the 5 most similar protocols

(+)–Catechin was from Uncaria gambir Roxb. The purity of (+)–catechin was approximately 99.9 % and were purchased from PT. Andalas Sitawa Fitolab, Padang, Indonesia (Code: RC-03401). Mouse 3T3-L1 fibroblast (CL-173) was kindly given by Prof. M. Taher. from International Islamic University Malaysia (IIUM). Glucose uptake kit was Promega Glucose Uptake-Glo™ J1342 (Madison, Wisconsin, USA). TRIzol reagent was purchased from Invitrogen (Waltham, Massachusetts, USA). cDNA Synthesis Kit was purchased from Bioline BIO-65054 (Tauton, MA, USA). cDNA was amplified using PCR Bioline SensiFAST SYBR No-ROX kit BIO-98005 (Tauton, MA, USA). All other chemicals were analytical grade and purchased from Sigma Aldrich, Singapore. The period of study was from February 2017 to September 2019.

Arundita S., Ismed F., Rita R.S, & Putra D.P. (2020). (+)-Catechin & Proanthocyanidin Fraction of Uncaria gambir Roxb. Improve Adipocytes Differentiation & Glucose Uptake of 3T3-L1 Cells Via Sirtuin-1, Peroxisome Proliferator-Activated Receptor γ (PPAR γ), Glucose Transporter Type 4 (GLUT-4) Expressions. Advanced Pharmaceutical Bulletin, 10(4), 602-609.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

After growth for 7 d in LD conditions, RNA was extracted from 100mg of seedling tissue using the Spectrum RNA kit (Sigma-Aldrich). A 1–2 μg aliquot of RNA was used to produce cDNA with a Superscript III (Life Technologies) or cDNA synthesis kit (Bioline). Non-quantitative PCR for mutant analysis was performed using Red-Hot Taq (Bioline). Real-time PCR was performed with SYBR-Green, Platinum Taq (Life Technologies), using primers for gene expression shown in Supplementary Table 2 at JXB online on an MJ Research Opticon 2 machine with Opticon Monitor 3 software. Quantification of expression was determined from ≥3 experiments and the values derived using the comparative C_T method (2^–ΔΔCt) (Schmittgen and Livak, 2008 ) with ACTIN7 (At5g09810) as the internal control. Control genes At4g33060 and At3g10040 were selected at random from a data set produced from study of the Arabidopsis hypoxia response (Licausi et al., 2011 (link)). From the microarray data described in Fig. 6, the fold change in log₂ expression compared with Col-0 in At4g33060 is 0.054 (nup160-1) or 0.048 (nup62-2) and in At3g10040 is 0.144 (nup160-1) or 0.104 (nup62-2).

, & Parry G. (2014). Components of the Arabidopsis nuclear pore complex play multiple diverse roles in control of plant growth. Journal of Experimental Botany, 65(20), 6057-6067.

+ Open protocol

+ Expand

Total RNA Extraction and Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with TRIzol reagent (Life Technologies, United States) and cDNA was generated by cDNA synthesis Kit (Bioline, United States), according to the manufacturer's instructions. Following RT-PCR and gel electrophoresis, purified DNA bands were sent for Sanger sequencing by Eton Bioscience INC (NC, United States).

Tang Y., Qin F., Liu A, & Li H. (2017). Recurrent fusion RNA DUS4L-BCAP29 in non-cancer human tissues and cells. Oncotarget, 8(19), 31415-31423.

+ Open protocol

+ Expand

Phage Infection Kinetics and Transcriptional Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

A similar approach was taken as previously described [85 (link),86 (link)]. Freshly grown host bacteria (strain DSM 30186) at an OD₆₀₀ of 0.20–0.23 was infected with phage CB7 at an MOI of 5 × 10⁻⁴, in the same manner as described for the single-step growth curve assay above. At 15, 30, and 45 min intervals, 1 mL of infected cells was pelleted and resuspended in phosphate buffer saline (PBS). Next, total RNA was extracted using the High Pure RNA Roche extraction kit (Roche, Basel, Switzerland) and subsequently, RT-PCR was performed using the cDNA synthesis kit (Bioline, London, UK) according to the manufacturer protocol. PCRs were performed using RedTaq ReadyMix (Sigma-Aldrich, St. Louis, MO, USA) to amplify products using primers specific to regions situated at the 5′ and 3′ ends of HNH endonuclease(s) being examined, with cDNA and CB7 genomic DNA as controls. These products were then inspected by agarose gel electrophoresis and Sanger sequencing for the presence of splicing. Primers used in PCRs are detailed in Supplementary information 1, Table S13.

Buttimer C., Lynch C., Hendrix H., Neve H., Noben J.P., Lavigne R, & Coffey A. (2020). Isolation and Characterization of Pectobacterium Phage vB_PatM_CB7: New Insights into the Genus Certrevirus. Antibiotics, 9(6), 352.

+ Open protocol

+ Expand

Quantifying HER2 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cultured cells using RNeasy^® Mini Kit (Qiagen) according to the manufacturer's instructions, quantified using Thermo Scientific NanoDrop^® ND-100, and then converted to cDNA using cDNA Synthesis Kit (Bioline, London, UK). HER2 expression was determined using 5′–AGTACCTGGGTCTGGACGTG–3′ (forward) and 5′–CTGGGAACTCAAGCAGGAAG -3′ (reverse) as primer sequences. PCR reactions were prepared using 2.0 μL of cDNA diluted in SensiMix™ SYBR kit (Bioline). qRT-PCR analysis was performed using the Applied Biosystems 7300-HT Real-Time PCR System. Levels of genes mRNA were expressed in relative copy numbers normalized against the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (comparative C_t method, 2^–ΔΔCt).

Paris L., Podo F., Spadaro F., Abalsamo L., Pisanu M.E., Ricci A., Cecchetti S., Altabella L., Buoncervello M., Lozneanu L., Bagnoli M., Ramoni C., Canevari S., Mezzanzanica D., Iorio E, & Canese R. (2017). Phosphatidylcholine-specific phospholipase C inhibition reduces HER2-overexpression, cell proliferation and in vivo tumor growth in a highly tumorigenic ovarian cancer model. Oncotarget, 8(33), 55022-55038.

+ Open protocol

+ Expand

Quantifying Cytokine Expression in Murine Colon

Check if the same lab product or an alternative is used in the 5 most similar protocols

Snap frozen colon segments were homogenised using a Tissue lyzer II with a Stainless-Steel Bead (5 mm) and RNA was extracted using a RNeasy^® Mini Kit (all Qiagen). cDNA was generated with a cDNA synthesis kit (Bioline). mRNA transcripts were quantified by quantitative PCR using TaqMan gene expression assays for IL-13 (Mm0043204_m1), IL-5 (Mm00439646_m1), IL-4 (Mm00445259_ m1), IFNγ (Mm01168134_m1) and IL-17A (Mn00439619_m1) (Applied Biosystems, Warrington, UK). Gene expression was normalised to the expression of β-actin (4352341E) to generate ΔCT values and relative abundance was quantified using the 2^−ΔCT method.

Garrido-Mesa N., Schroeder J.H., Stolarczyk E., Gallagher A.L., Lo J.W., Bailey C., Campbell L., Sexl V., MacDonald T.T., Howard J.K., Grencis R.K., Powell N, & Lord G.M. (2018). T-bet controls intestinal mucosa immune responses via repression of type 2 innate lymphoid cell function. Mucosal Immunology, 12(1), 51-63.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cells using ReliaPrep™ RNA Cell Miniprep System (Promega). Up to 2 μg RNA was used to generate cDNA, using a cDNA synthesis kit (Bioline). RT-qPCR analysis was carried out using CFX96/384 instruments (Bio-Rad) and the GoTaq qPCR Mastermix Kit (Promega). RT-qPCR primer sequences are listed in Supplementary Table 1 and were purchased from Eurofins. Due to very low expression levels, ADAMTS10 gene expression analysis was performed using TaqMan probes (Hs01548644_g1 (ADAMTS10), ThermoFisher Scientific), with matching reference gene primers. Expression analysis used CFX Manager Software v3.1 (Bio-Rad), with samples normalized to a combination of TATA box binding protein (TBP) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression. Gene expression data are in Supplemental Information.

Cain S.A., Mularczyk E.J., Singh M., Massam-Wu T, & Kielty C.M. (2016). ADAMTS-10 and -6 differentially regulate cell-cell junctions and focal adhesions. Scientific Reports, 6, 35956.

+ Open protocol

+ Expand

Quantifying Gene Expression in Mice Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression levels were quantified using real-time PCR assay. Mice TAMs were powdered under liquid nitrogen and homogenized using Fast prep-24 (MP Biomedicals, NSW, Australia) in Trizol (Invitrogen, Australia). Epididymal and subcutaneous adipose tissue and liver were homogenized as above. Total RNA was then extracted as per the manufacturer’s instructions and resuspended in nuclease-free water. Genomic DNA contamination of RNA preparations was eliminated by digestion with DNase I amplification grade (Invitrogen, Australia). cDNA was synthesized from 1 µg total RNA using cDNA synthesis kit (Bioline, NSW, Australia) and RT-PCR was performed using the SYBR Hi-ROX kit (Bioline) on a 7900HT Fast Real-time PCR system (Ambion Life Technologies). Results are quoted to the mRNA level compared to TATA box, the expression of which was unchanged by the treatments. Primer sequences are listed in Supplementary Table S1.

Keshvari S., Henstridge D.C., Ng C., Febbraio M.A, & Whitehead J.P. (2017). Muscle-specific overexpression of AdipoR1 or AdipoR2 gives rise to common and discrete local effects whilst AdipoR2 promotes additional systemic effects. Scientific Reports, 7, 41792.

+ Open protocol

+ Expand

Quantitative PCR for Cytokine Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Snap frozen colon segments were homogenised using a Tissue lyzer II with a Stainless-Steel Bead (5 mm) and RNA was extracted using a RNeasy^® Mini Kit (all Qiagen). cDNA was generated with a cDNA synthesis kit (Bioline). mRNA transcripts were quantified by quantitative PCR using TaqMan gene expression assays for IL-13 (Mm0043204_m1), IL-5 (Mm00439646_m1), IL-4 (Mm00445259_m1), IFNγ (Mm01168134_m1) and IL-17A (Mn00439619_m1) (Applied Biosystems, Warrington, UK). Gene expression was normalised to the expression of β-actin (4352341E) to generate ΔCT values and relative abundance was quantified using the 2^−ΔCT method.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!