Blend taq polymerase

Total RNA was extracted from expanded leaves using Seprasol RNA 1 Super G (Nacalai Tesque, Kyoto, Japan) according to the manufacturer’s instructions. Extracted RNAs were purified once using a commercial agent [High-Salt Solution for Precipitation (Plant), TaKaRa Bio Inc.] according to the manufacturer’s instructions. RT was performed in a 5 μL volume containing 25 units of ReverTra Ace (Toyobo, Osaka, Japan), 0.5 μL RT buffer, 1 mM dNTPs (10 mM), 10 units of RNase inhibitor (Toyobo), and 1 μM reverse primer CSVd-R [5′-AGGATTACTCCTGTCTCGCA-3′; Hosokawa et al., 2004b (link)]. Total RNA was added to the reaction mixture to a final concentration of 10–20 ng⋅μL^-1, and then, this mixture was incubated at 42°C for 30 min and 99°C for 5 min. One μL of RT product was added to 9 μL of the PCR mixture to obtain a final volume of 10 μL. RT-PCR was performed in a 10 μL mixture containing 0.25 units of Blend Taq polymerase (Toyobo), reaction buffer for the Blend Taq polymerase, 0.2 mM dNTPs, and 0.2 μM forward and reverse primers. One cycle of 3 min at 98°C, 35 cycles of 30 s at 98°C, 10 s at 58°C, and 30 s at 74°C, and one cycle of 5 min at 74°C were performed. The primers CSVd-R and CSVd-F (5′-CAACTGAAGCTTCAACGCCTT-3′; Hosokawa et al., 2004b (link)) were used. The RT-PCR products were separated by electrophoresis on a 1.0% agarose gel and visualized by ethidium bromide staining.

Seeds from each line were sown onto two nylon‐mesh floats on the culture solution in the absence of biuret and grown for two days, to achieve uniform germination. Then, one of the two floats were transferred into a new 2‐L container that did not contain biuret and the other was transferred into another 2‐L container containing 0.3 mmol/L biuret. Plants were harvested 7 days after the onset of the biuret treatment. After determining plant heights, leaf blades from the third leaf were used to determine the chlorophyll content, and leaf blades from the second leaf were used for DNA extraction. Chlorophyll was extracted from tissues using 80% aqueous acetone buffered with 2.5 mmol/L sodium phosphate buffer (pH 7.8), and its levels were determined according to the method described by Porra et al. (1989). The presence of the transgene was confirmed by the PCR method, using Blend Taq polymerase (Toyobo, Osaka, Japan) and the primers 5′‐ATGAAGACACTTTCCAGCGC‐3′ and 5′‐TGGCAAATGCCTCTCAAGG‐3′, and the data for plants not carrying the transgene were omitted from the analysis.

The 16S rRNA gene regions were amplified with Blend Taq polymerase (Toyobo, Osaka, Japan) and sequenced by direct PCR using universal forward (27f) and reverse (1492r) primers (Lane, 1991 ). The PCR conditions were as follows: preheating at 94°C for 2 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 90 s; extension at 72°C for 60 s; a final extension at 72°C for 5 min, and cooling at 12°C. For direct PCR sequence analysis with the 27f primer, an ABI Prism 3130xl genetic analyzer was used with a BigDye Terminator v. 3.1 Cycle Sequencing Ready-Reaction Kit (Applied Biosystems, Foster City, CA, United States). Phylogenetic trees of the gene sequences were constructed in MEGA v. 7.0 software (Tamura et al., 2011 (link)) by using the neighbor-joining method (Saitou and Nei, 1987 (link)).

Total RNA was extracted from cells with ISOGEN reagent (Nippon Gene Co. Ltd., Tokyo, Japan). The first-strand cDNA was synthesized from total RNA with PrimeScript Reverse Transcriptase (Takara Bio, Shiga, Japan). GAPDH mRNA was determined as a positive control. PCR was done by incubating cDNA with appropriate primers (0.5 μM each), Blend Taq polymerase (1.25 U: Toyobo, Osaka, Japan) and deoxynucleotide mix (0.2 mM each: Toyobo). The reaction conditions were as follows: 94°C for 2 min, followed by 30 cycles of 94°C for 30 sec, 56°C for 1 min, and 72°C for 2 min, with final extension at 72°C for 10 min. The primer sequences were as follows: IL-6 (236 bp), 5’-agagtagtgaggaacaagcc-3’ (sense) and 5’-tacatttgccgaagagccct-3’ (anti-sense); GAPDH (258 bp), 5’-agaaggctggggctcatttg-3’ (sense) and 5’-aggggccatccacagtcttc-3’ (anti-sense). The products were then subjected to 2% agarose gel electrophoresis. Bands were stained with ethidium bromide (Wako) and photographed.

Total RNA was extracted from astrocytes, microglia, and neurons using an RNeasy Mini Kit (Qiagen, Tokyo, Japan). A first-strand cDNA library was obtained using SuperScript II (Invitrogen, Carlsbad, CA) and oligo (dT) 12-18 (Invitrogen) as the first-strand primer. Negative control reactions were performed using the same system after heat denaturation of reverse transcriptase. RT-PCR was used to amplify transcripts encoding mouse FGF-2, each receptor subtypes and glyceraldehydes-3-phosphate dehydrogenase (GAPDH), using 0.1 μg of first-strand cDNA, Blend Taq polymerase (Toyobo Co., Osaka, Japan), and oligonucleotide primers (Table 1; except for previously described primers for GAPDH [25 (link)]).