Agencourt ampure magnetic bead

Manufactured by Beckman Coulter

Sourced in United States

Agencourt AMPure magnetic beads are a nucleic acid purification solution used for the selective isolation and purification of DNA and RNA from biological samples. The product utilizes carboxylated magnetic beads to bind and capture nucleic acids, allowing for efficient removal of contaminants through a series of washing steps.

Automatically generated - may contain errors

Lab products found in correlation

16 protocols using agencourt ampure magnetic bead

Fungal ITS1 Amplification and Qualification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fungal ITS1 amplicons were typically generated in 20 uL PCR reactions using 1 ng of each sample with 35 cycles using Phusion DNA Polymerase (New England BioLabs) at an annealing temperature of 56.1°C using the primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC)(Gardes and Bruns, 1993 (link)). While this generally yields sufficient amplification of ITS1 targets (and did so for samples used in this study), we sometimes identified samples in which fungal content is underrepresented in 1 ng of DNA (Supplementary Fig. 1B). In such cases, the cycles of amplification and amount of sample added for each ITS amplicon PCR must be adjusted according to the cycle threshold (Ct) of the microbiota/host qPCR in order to normalize all sample reactions to the same amount of fungal template. Resultant ITS amplicons were purified using Agencourt AmPure Magnetic Beads (Beckman Coulter), resuspended in 20 μL of nuclease-free water, and quantified using a Qubit fluorometer. Amplicons were further qualified using the DNA 1000 assay on the Agilent Bioanalyzer (Agilent Technologies).

Tang J., Iliev I.D., Brown J., Underhill D.M, & Funari V.A. (2015). Mycobiome: Approaches to Analysis of Intestinal Fungi. Journal of immunological methods, 421, 112-121.

+ Open protocol

+ Expand

Transcriptomic Profiling of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions and then purified with Agencourt AMPure magnetic beads (Beckman Coulter, USA). Target preparation for microarray processing was performed according to the instructions provided in the GeneChip® WT PLUS Reagent Kit (Thermo Fisher Scientific, USA). After hybridization with Affymetrix Human Gene 1.0ST Array chips, the microarrays were washed, stained with streptavidin-phycoerythrin on Affymetrix Fluidics Station 450 (Affymetrix, USA), and then scanned using an Affymetrix® GeneChip Command Console installed in a GeneChip® Scanner 3000 7G (Affymetrix, USA). The microarray data were analyzed by the robust multichip analysis (RMA) algorithm using the default analysis settings and global scaling as the normalization method with Partek® Genomics Suite 6.6. The log2-transformed values of the RMA signal intensities were calculated, and differential expression analysis was further performed by one-way analysis of variance (ANOVA).

Hu M., Zheng Y., Liao J., Wen L., Cheng J., Huang J., Huang B., Lin L., Long Y., Wu Y., Ye X., Fu Y., Qi H., Baker P.N, & Tong C. (2022). miR21 modulates the Hippo signaling pathway via interference with PP2A Bβ to inhibit trophoblast invasion and cause preeclampsia. Molecular Therapy. Nucleic Acids, 30, 143-161.

+ Open protocol

+ Expand

Bacterial 16S rRNA Gene Amplification and Sequencing

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The bacterial communities for each sample was processed as described previously^{22 (link)}. In brief, the V3-V4 region of the bacterial 16S rRNA gene was amplified using the S-D-Bact-0341-b-S-17/S-D-Bact-0785-a-A-21^{29 (link)} primer pair containing Nextera library prep kit adapters. Approximately 100 ng of genomic template DNA was used in duplicate PCRs, each consisting of 35 cycles. Negative PCR controls were included in all PCR reactions as well as elute from the negative extraction control, which yielded no detectable products. Duplicate PCR products were pooled to a final volume of 50 µL and purified using Agencourt AMPure magnetic beads (Beckman Coulter Inc., USA) according to the manufacturer’s instructions. Purified PCR products were quantitatively assessed with Qubit dsDNA high-sensitivity kits (Life Technologies, New Zealand) and standardised to ~ 5 ng per sample. The purified products were submitted to the Auckland Genomics Centre for library preparation and sequencing on the Illumina MiSeq 2 × 300 base pair platform with pair end reads. Raw sequence reads are stored on a publicly available database (NCBI) under BioProject number PRJNA638970.

Biswas K., Wagner Mackenzie B., Ballauf C., Draf J., Douglas R.G, & Hummel T. (2020). Loss of bacterial diversity in the sinuses is associated with lower smell discrimination scores. Scientific Reports, 10, 16422.

+ Open protocol

+ Expand

16S Amplicon Sequencing of Microbial Communities

Check if the same lab product or an alternative is used in the 5 most similar protocols

Paired-end adapters with unique indexes were ligated to 100 ng of 16S amplicons and used to generate Ion Torrent sequencing libraries using the Ion Xpress Library Kit (Life Technologies, Carlsbad, CA). Library enrichment was performed with 10 cycles of PCR and purified using Agencourt Ampure Magnetic Beads (Beckman). All libraries were subjected to quality control using qPCR, DNA 1000 Bioanalyzer (Agilent), and Qubit (Life Technologies, Carlsbad, CA). Pooled libraries were assayed on Agilent Bioanalyzer (Santa Clara, CA) to check final sizing and KAPA Biosciences qPCR for quantitation. 16S samples were multiplexed and sequenced on the Ion Torrent PGM on a 318 chip with 400 bp chemistry. 250 single-end sequencing-by-synthesis was performed using the MiSeq Illumina sequencer (Illumina, San Diego, CA). Torrent reads shorter than 200 bp, or not containing the designed 16S primers (>2 nt mismatches) were discarded. 300 bp sequences of remaining high-quality reads were aligned to the Greengenes reference database (February 2011 release) using BLAST v2.2.22 in QIIME v1.5 wrapper [15 (link)] with an identity percentage ≥97% to select the operational taxonomic units (OTUs). Taxonomy for each sequence was assigned using the Ribosomal Database Project (RDP) classifier v2.2.

Demehri F.R., Frykman P.K., Cheng Z., Ruan C., Wester T., Nordenskjöld A., Kawaguchi A., Hui T.T., Granström A.L., Funari V, & Teitelbaum D.H. (2015). Altered fecal short chain fatty acid composition in children with a history of Hirschsprung-associated enterocolitis,. Journal of pediatric surgery, 51(1), 81-86.

+ Open protocol

+ Expand

TFEB Chromatin Immunoprecipitation Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP was performed as previously described^{68 (link)}. Briefly, for each ChIP experiment 8–10 million cells were cross-linked with 1% formaldehyde (Pierce) for 10 min at room temperature, nuclei were isolated and chromatin was sonicated at 4 °C using a Bioruptor (Diagenode) for 25 cycles (30 s ‘ON’ and 30 s ‘OFF’, power setting high). For each immunoprecipitation 18 μl of antibody against TFEB (Cell Signaling, no. 37785, D2O7D) were incubated with chromatin at 4 °C with rotation overnight. Chromatin was washed, crosslink was reversed at 65 °C overnight and DNA was isolated using Agencourt AMPure magnetic beads (Beckman Coulter). Subsequently, qPCR was performed (StepOne, Applied Biosystems) using ChIP and input DNA amplifying different regions around the transcriptional start site of Acod1 (Irg1). Enrichment of TFEB binding was calculated as ChIP–DNA relative to input-DNA PCR signal for each primer pair and normalized to a negative control region (non-accessible heterochromatin region).

Schuster E.M., Epple M.W., Glaser K.M., Mihlan M., Lucht K., Zimmermann J.A., Bremser A., Polyzou A., Obier N., Cabezas-Wallscheid N., Trompouki E., Ballabio A., Vogel J., Buescher J.M., Westermann A.J, & Rambold A.S. (2022). TFEB induces mitochondrial itaconate synthesis to suppress bacterial growth in macrophages. Nature Metabolism, 4(7), 856-866.

+ Open protocol

+ Expand

Bacteriophage DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Prior to DNA extraction, the aliquot of bacteriophage lysate was filter–sterilized using a 10 ml syringe barrel fitted with a 0.22 μm filter Millex® GV filter unit (Merck) and maintained at 4°C prior to analysis. Bacteriophage particles were concentrated and purified using the method reported previously [27 (link)].
For DNA extraction, Qiamp DNeasy Blood and Tissue kit (Qiagen) was used following manufacturers’ instructions. DNA extracts were tested and concentrations adjusted to 0.2 ng μl^-1 using a Quantus fluorometer and Quantifluor dsDNA kit (Promega) following the manufacturer’s instructions. Agencourt®AMPure® magnetic beads (Beckman Coulter) and Nextra®XT Library Preparation (Illumina) kits were used following the manufacturer’s instructions. For tagmentation, 5 μl of diluted bacteriophage DNA was treated using the Nextra®XT Library Preparation (Illumina) kit following the manufacturer’s instructions. Next-generation sequencing (NGS) was performed using the MiSeq^™ sequencer (Illumina) with v2 2 x 250 sequencing reagents (Illumina) following the manufacturer’s instructions for denaturation of a 2 nM library.

Zaczek-Moczydłowska M.A., Young G.K., Trudgett J., Plahe C., Fleming C.C., Campbell K, & O’ Hanlon R. (2020). Phage cocktail containing Podoviridae and Myoviridae bacteriophages inhibits the growth of Pectobacterium spp. under in vitro and in vivo conditions. PLoS ONE, 15(4), e0230842.

+ Open protocol

+ Expand

Purification and Sequencing of 16S PCR Amplicons

Check if the same lab product or an alternative is used in the 5 most similar protocols

SRV3 16S PCR amplicons were purified using Agencourt AMPure magnetic beads (Beckman Coulter), assayed for purity and quantified using a nanodrop. Amplicons were pooled together in equal amounts (119 ng) and sent for sequencing (Massey Genome Service). Pooled amplicons were then distributed amongst six paired-end sequencing runs (of 250 bp) performed using an Illumina MiSeq (Massey Genome Service, New Zealand Genomics Limited). PhiX174 was used as a sequencing control.

Gregory S.J., Anderson C.W., Camps-Arbestain M., Biggs P.J., Ganley A.R., O’Sullivan J.M, & McManus M.T. (2015). Biochar in Co-Contaminated Soil Manipulates Arsenic Solubility and Microbiological Community Structure, and Promotes Organochlorine Degradation. PLoS ONE, 10(4), e0125393.

+ Open protocol

+ Expand

Illumina and Ion Torrent Library Preparation for ITS Amplicons

Check if the same lab product or an alternative is used in the 5 most similar protocols

Illumina paired-end adapters with unique indexes were ligated to 100 ng of ITS1 amplicons using the TruSeq DNA Nano Sample Preparation Kit (Illumina). Library enrichment was performed with 10 cycles of PCR and purified using Agencourt Ampure Magnetic Beads (Beckman). Successful ligation of Illumina adapters results in 120 base pair shifts in the size of ITS amplicons and are confirmed using Agilent DNA 1000 Bioanalyzer assays (Supplementary Fig. 1C). Qubit fluorometric assay (Life Technologies) is used for final quantitation and libraries were then pooled at equimolar concentrations.
Afterwards, 100 ng of pooled ITS amplicons were used to generate Ion Torrent sequencing libraries using the Ion Xpress Library Kit (Life Technologies). Adapters and primers were diluted 1:10 to accommodate for the low input into the library preparation. Libraries were barcoded using Ion Xpress Barcode Adapter Kit (Life Technologies) to allow for multiplexed sequencing. Libraries were quantified and qualified in the same manner as the Illumina libraries.

Tang J., Iliev I.D., Brown J., Underhill D.M, & Funari V.A. (2015). Mycobiome: Approaches to Analysis of Intestinal Fungi. Journal of immunological methods, 421, 112-121.

+ Open protocol

+ Expand

Bacterial 16S rRNA Gene Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate bacterial communities the V3-V4 region of the bacterial 16S rRNA gene was amplified using 341F and 806R primers (Herlemann et al., 2011 (link)) together with Nextera DNA library prep kit adapters. PCR reactions and DNA purification were carried out as described elsewhere (Hoggard et al., 2017 (link)). In brief, approximately 100 ng of genomic template DNA was used in duplicate PCRs, each consisting of 35 cycles. Negative PCR controls were included in all PCR reactions as well as eluate from the negative extraction control, which yielded no detectable products. Amplicons from duplicate PCRs were pooled to a final volume of 50 uL and purified using Agencourt AMPure magnetic beads (Beckman Coulter Inc., USA). Purified PCR products were quantitatively assessed with Qubit dsDNA high-sensitivity kits (Life Technologies, New Zealand) and standardised to ~ five ng per sample. Purified products were submitted to Auckland Genomics Ltd for library preparation and sequencing using Illumina MiSeq (2 x 300 bp paired-end chemistry). Raw sequences are publicly available on the SRA-NCBI database (BioProject ID: PRJNA639396).

Lux C.A., Johnston J.J., Waldvogel-Thurlow S., Dassi C., Douglas R.G., Cho D.Y., Taylor M.W, & Biswas K. (2021). Unilateral Intervention in the Sinuses of Rabbits Induces Bilateral Inflammatory and Microbial Changes. Frontiers in Cellular and Infection Microbiology, 11, 585625.

+ Open protocol

+ Expand

Amplicon Library Preparation for Ion Torrent and Illumina

Check if the same lab product or an alternative is used in the 5 most similar protocols

Paired-end adapters with unique indexes were ligated to 100 ng of 16S amplicons and used to generate Ion Torrent sequencing libraries using the Ion Xpress Library Kit (Life Technologies, Carlsbad, CA). Illumina paired-end adapters with unique indexes were ligated to 100 ng of ITS-1 amplicons using a modified TruSeq DNA Sample Preparation (Illumina, San Diego, CA) where adapters and PCR primers were diluted 1:10 to accommodate lower input of amplicon mass for both 16S and ITS-1 preparations. Library enrichment was performed with 10 cycles of PCR and purified using Agencourt Ampure Magnetic Beads (Beckman). All libraries were subjected to quality control using qPCR, DNA 1000 Bioanalyzer (Agilent), and Qubit (Life Technologies, Carlsbad, CA) to validate and quantitate library construction then pooled at equimolar concentrations.

Frykman P.K., Nordenskjöld A., Kawaguchi A., Hui T.T., Granström A.L., Cheng Z., Tang J., Underhill D.M., Iliev I., Funari V.A, & Wester T. (2015). Characterization of Bacterial and Fungal Microbiome in Children with Hirschsprung Disease with and without a History of Enterocolitis: A Multicenter Study. PLoS ONE, 10(4), e0124172.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!