Quantstudio 6 pro

Male or female reproductive tracts were dissected in pools of 16, collected in TRI reagent (Thermo Fisher Scientific), and stored at −80 °C. RNA was extracted according to the manufacturer’s instructions, with an additional three ethanol washes of pelleted RNA. Following resuspension, RNA was treated with Turbo DNAse (Thermo Fisher Scientific), quantified with a Nanodrop 2000C (Thermo Fisher Scientific), and then 0.75–2 µg were used in a 100 µl complementary DNA synthesis reaction, following standard protocols. We designed primers for RT–qPCR (QuantStudio 6 pro, Thermo Fisher Scientific) using NCBI PrimerBLAST^{54 (link)} and after evaluating four different primer sets for cifB, we used the following primers for cifA and cifB at the following concentrations: cifAF, 5ʹ tcgccgagctgatcgtgaa 3ʹ (300 nM); cifAR, 5ʹ atcatgtccaggatctccttcttctc 3ʹ (300 nM); cifBF, 5ʹ AGAAGGACCGCCTGATCG 3ʹ (900 nM); cifBR, 5ʹ AGGCTATCGGCGTAGTAGCC 3ʹ (900 nM); RpL19F, 5ʹ CCAACTCGCGACAAAACATTC 3ʹ (300 nM); and RpL19R, 5ʹ ACCGGCTTCTTGATGATCAGA 3ʹ (900 nM). Relative quantification was determined using the 2^{−(ΔCt (cycle threshold))} equation, using RpL19 as the standard. For female cifA expression (Fig. 2a), transcript levels were not found to be different between samples from cifA only or cifA and cifB co-expressing individuals, so these data were pooled.

Extracted RNAs were treated with demethylase cocktails (Arraystar), according to the manufacturer’s instruction and were then cleaned up with Quick RNA microprep kit (Zymo Research). Next, poly (A) tailing of demethylated RNAs was performed with E. coli poly (A) polymerase (NEB) at 37 °C for 30 min. Demethylated, poly (A)-tailed RNAs were reverse transcribed with anchored oligo d(T) primers, d(T)₂₃VN (IDT), using ProtoScript II reverse transcriptase (NEB). SYBR Green-based, real-time quantitative PCR (qPCR) detection (NEB) was performed using CFX96 touch PCR machine (Bio-Rad) or QuantStudio™ 6 Pro (Thermo). The primers used in this study were listed in Supplementary Fig. S2.

Eight-week-old mice were deeply anesthetized with isoflurane, decapitated, and the entire brain was removed rapidly from the skull. The whole brain was sliced into 1 mm sections using a brain matrix (Brainscience Idea, Osaka, Japan), and the striatum, hippocampus, and corpus callosum were removed from sections using a razor blade. Removed sections were placed in RNAlater, kept at 4 ℃ overnight, and then frozen at − 80 ℃.
RNA was extracted from tissue using RNeasyMiniKit (Qiagen) and reverse transcribed into cDNA with the ReverTra Ace® qPCR RT Master Mix (Toyobo). Quantitative real-time PCR was performed using GeneAce SYBR® qPCR Mix a Low Rox (NIPPON GENE) reagent and QuantStudio 6 pro (Thermo Fisher). Quantification was done using a relative standard curve, and βActin was used as an internal control. qPCR run method and Primer information is shown in Additional file 2.
Prior to statistical analysis of quantitative real-time PCR data, the cuprizone group mRNA expression levels were normalized to the control group for each brain region. Fluorescence intensity and quantitative real-time PCR statistical results are shown as mean ± SEM.