The largest database of trusted experimental protocols

Fish detection kit

Manufactured by RiboBio
Sourced in China, Puerto Rico

The FISH Detection Kit is a laboratory tool designed for the detection and analysis of specific DNA or RNA sequences within cells or tissue samples. The kit contains the necessary reagents and materials for performing Fluorescence In Situ Hybridization (FISH) experiments. FISH is a widely used technique in genetic and molecular research, allowing for the direct visualization and localization of target genetic sequences within the cellular context.

Automatically generated - may contain errors

10 protocols using fish detection kit

1

Fluorescent Probing of CircRIMS1 and miR-433-3p

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cy3-circRIMS1 and fluorescein isothiocyanate (FITC)-miR-433-3p probes were synthesized and obtained from RiboBio (Guangzhou, PR China). Hybridization assays were performed using a FISH Detection Kit (RiboBio, PR China). All images were captured by a confocal microscope (FV1000; Olympus, Tokyo, Japan). The sequences of the probes are listed in Table S1.
+ Open protocol
+ Expand
2

LINC00638 and miR-4732-3p Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
PLC/PRF/5 and MHCC97H cells were cultured in glass chamber slides, fixed with 4% paraformaldehyde, and permeated with 0.1% Triton X-100. After washing and treating with pre-hybridization buffer, hybridization was carried out by using a FISH detection kit (Ribo Biotechnology Co., Ltd.) including probes for LINC00638 (GCTCCGTAGCCTATTCACCCCCACCAGACCCTT) and miR-4732-3p (CAGAACAGGACAGGTCAGGGC). The nuclei were stained with 4′,6-diamidino-2-phenylindole and dihydrochloride (DAPI).
+ Open protocol
+ Expand
3

Detecting LINC00908 RNA in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA FISH experiments were performed to detect LINC00908 RNA in BC cells using the FISH Detection Kit (Ribo) according to the protocol.
+ Open protocol
+ Expand
4

Detecting circ-0000437 RNA in EC cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To detect circ-0000437 RNA in EC cells, RNA FISH experiments were performed with FISH Detection Kit (Ribo) in EC cell lines according to the protocol. Cells cultured on coverslips were fixed with 4% paraformaldehyde at 4 °C for 15 min and washed three times with PBS. The samples were subsequently incubated with Pre-Hybridization Buffer at 37 °C for 30 min and Hybridization Buffer with FISH probes at 37 °C overnight in the dark using a RiboTM Fluorescent In Situ Hybridization Kit (RiboBio). On the next day, the coverslips were washed three times with wash buffer I (4 × SSC with 0.1% Tween-20), once each with wash buffer II (2 × SSC) and wash buffer III (1 × SSC) at 42 °C in the dark for 5 min and once with PBS at room temperature. Then, the cells were stained with DAPI in the dark for 10 min. The has-circ-000437-Cy3 FISH probes were designed and synthesized by RiboBio Co, Ltd. Human U6 FISH probes (RiboBio) and Human 18S FISH probes (RiboBio) were used as nuclear and cytoplasmic controls, respectively.
+ Open protocol
+ Expand
5

Fluorescence In Situ Hybridization for lncRNA XIST

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cells were placed on glass chamber slides and cultured. The cells were first fixed with 4% paraformaldehyde in PBS for 30 min, and then permeabilized with 0.1% Triton X-100. Next, the cells were washed and treated with pre-hybridization buffer. The FISH detection kit including probes for lncRNA XIST and U6 was purchased from RiboBio Co., Ltd. (Guangzhou, China). Hybridization was carried out in a humidified chamber for 16 h, followed by staining with DAPI.
+ Open protocol
+ Expand
6

Cy3-labeled circXRN2 Probe FISH Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Cy3-labeled circXRN2 probe was synthesized and obtained from RiboBio (Guangzhou, PR China). Later, a FISH Detection Kit (RiboBio, PR China) was employed according to the manual. Cell nuclei were stained with DAPI. The results were captured by a microscope (Olympus, Tokyo, Japan). The details of the probe used in this study are listed in Supplementary file 3.
+ Open protocol
+ Expand
7

Fluorescence in situ Hybridization for circPPP1CB and miR-1307-3p

Check if the same lab product or an alternative is used in the 5 most similar protocols
Probes of Cy3-circPPP1CB and FITC-miR-1307-3p were synthesized. Fluorescence in situ hybridization (FISH) detection kit (RiboBio, China) was used for hybridization experiments. All images were photographed with a Zeiss Axio Observer A1 (Carl Zeiss, Germany).
+ Open protocol
+ Expand
8

Subcellular Localization of LINC00205 by RNA-FISH

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RNA fluorescence in situ hybridization (RNA-FISH) analysis was used to detect the subcellular location of LINC00205 using FISH Detection Kit (RiboBio, Guangzhou, China) in both GC tissues and cell lines. Fluorescence-labeled probes specially for LINC00205 (red) and DAPI (blue) for nuclear detection were used. Images were captured using LSM 800 confocal microscope (Carl Zeiss, Jena, Germany).
+ Open protocol
+ Expand
9

Fluorescent Probes for circRNA and miRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cy3-CircCCT3 and fluorescein isothiocyanate (FITC)-miR-613 probes were synthesized and obtained from RiboBio (Guangzhou, PR China). Hybridization assays were performed using a FISH Detection Kit (RiboBio, PR China). All images were captured by a confocal microscope (FV1000; Olympus, Tokyo, Japan).
+ Open protocol
+ Expand
10

Fluorescent In Situ Hybridization Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cy3-CircCCT3 and uorescein isothiocyanate (FITC)-miR-613 probes were synthesized and obtained from RiboBio (Guangzhou,PR China). Hybridization assays were performed using a FISH Detection Kit (RiboBio, PR China). All images were captured by a confocal microscope (FV1000; Olympus, Tokyo, Japan).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!