Takyon no rox sybr master mix blue dttp

Gene expression was determined by quantitative RT-PCR as described in detail before [20 (link)]. Briefly, mRNA was extracted with Qiagen column extraction kit and reverse transcribed with M-MLV reverse transcriptase (InVitrogen, Cergy Pontoise, France). RT-PCR reactions were done in 5 µL with Takyon NO ROX SYBR Mastermix blue dTTP (Eurogentec, Angers, France) on a Lightcycler (LC480, Roche Life Science, Penzberg, Germany). Quantification was done with the ΔΔCT method with 28S RNA for normalization. Primers used for each gene are indicated in Supplementary Table S1.

The qPCRs were performed in triplicate using Takyon No ROX SYBR MasterMix blue dTTP (Eurogentec, Liège, Belgium) and a Mastercycler Realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany). The cycling program was: 5 min at 95 °C followed by 40 cycles of 15 s at 95 °C and 45 s at the annealing temperature indicated in Table 1. Relative expression of Cyclin D1 transcripts was standardized using 3 housekeeping transcripts (EIF3F, RPL13A and PPIA) using a method previously described [22 (link)]. Primers used to amplify transcripts were designed in different exons to avoid the amplification of potential genomic DNA traces. Primer specificity was checked using a Basic Local Alignment Search Tool (BLAST) search through the US National Center for Biotechnology Information (Bethesda, MD, USA).

Total RNA (600 ng) was reversely transcribed using random hexamers (Promega, Madison, WI, USA, C1181). A qPCR was performed using Takyon™ No Rox SYBR Master Mix blue dTTP (Eurogentec, Liege, Belgium, UF-NSMT-B0710), cDNA (6 ng), forward and reverse primers (300 nM), and the following protocol: 50 °C 2 min, denaturation at 95 °C 10 min, 40 cycles of amplification (15 s 95 °C and 1 min 60 °C) (Bio-Rad CFX96 Real-Time PCR Detection System). Data were analyzed using the standard curve method (Bio-Rad CFX Manager Software version 1.1). The relative quantification of target gene expression was normalized to a reference gene and gene expression data were log-transformed for the analysis. Primer sequences are listed in Table S6.

Total RNA was extracted using TriZol reagent (GE Healthcare, UK), and the RNA was purified with the RNeasy Plant Mini Kit (Promega, USA), according to the manufacturer’s protocols. cDNA was subsequently synthesized using the GoScript™ Reverse Transcription System (Promega, USA). Quantitative real-time PCR was done using Takyon™ No Rox SYBR® MasterMix blue dTTP (Eurogentec, Belgium) and the LightCycler 480 (Roche, Switzerland). Primers used are presented in Supplementary Table S1 at JXB online. All reported results are presented normalized with the ACTIN2 control gene but behave similarly if normalized with ACTIN7 or GAPDH control genes.

Total RNA was extracted from splenic DCs or BMDCs using the NucleoSpin^®RNA Plus kit (Macherey-Nagel, Düren, Germany) and reverse transcribed using random primers, dNTP, RNAseout, DTT, and MML-V reverse transcriptase (all from Invitrogen, Cergy Pontoise, France), following the manufacturer’s instructions.
qPCRs were performed in triplicate using Takyon No ROX SYBR MasterMix blue DTTP (Eurogentec, Liège, Belgium) and a Mastercycler Realplex² Real-Time PCR System (Eppendorf, Hamburg, Germany). The cycling program was 5 min at 95 °C followed by 40 cycles of 15 s at 95 °C and 45 s at the annealing temperature indicated in Table 1. The relative expression of transcripts of interest was standardized using 2 housekeeping transcripts (Gusb/Eif3f for BMDCs and Gusb/Ef1a for splenic DCs) using a method previously described [32 (link)]. Primers (Eurogentec, Liège, Belgium) used to amplify transcripts were designed in different exons to avoid the amplification of potential genomic DNA traces. Primer specificity was checked using a Basic Local Alignment Search Tool (BLAST) search through the US National Center for Biotechnology Information (Bethesda, MD, USA).

All strains were maintained at 20 °C without starvation prior to experiment. Total RNA purified from age-synchronized young adult C. elegans was prepared using TRI Reagent (Sigma-Aldrich, St. Louis, MO, USA) and an RNA clean and concentrator kit (Zymo Research Corp., Irvine, CA, USA). DNase treatment was performed using the on-column DNase digestion (Qiagen, Hilden, Germany). Reverse transcription was performed by SuperScript IV (Invitrogen) and oligo-dT primer. Quantitative PCR was performed on a Roche LightCycler 480 using the Takyon No Rox SYBR MasterMix blue dTTP (Eurogentec, Seraing, Belgium). qPCR reactions were performed in at least three independent samples in triplicates. Samples were analyzed by the 2^−ΔΔCt method, with normalization to the geometric mean of the reference genes cdc-42 and Y45F10D.4. Significant differences were assessed by Student’s unpaired t-test. Primer sequences were: fat-5: 5′TCCAGAGGAAGAACTACC3′ and 3′TCATTCCAGTCGTCCTCT5′, fat-7: 5′GCGCTGCTCACTATTTTGGT3′ and 3′CGTTGGTGAAGGAGGTCACA5′, cdc-42: 5′CTGCTGGACAGGAAGATTACG3′ and 3′CTTCATTCGAGAATGTCCGAG5′, Y45F10D.4:5′ GTCGCTTCAAATCAGTTCAGC3′ and 3′GTCGGATCACTTGACAAGAAC5′.