All chemicals and drugs were obtained from Sigma-Aldrich, if not otherwise stated. Bradykinin was purchased from Abcam. 3,5-bis(trifluoromethyl)pyrazole (BTP2) a TRPC channel blocker was obtained from Santa Cruz. Rat angiotensin II type 1 receptor, AT1R, with Venus fused at C-terminus was used for Ca2+ experiments [15 (link)]. The HA-tagged AT1R was made by insertion of PvuI restriction site through mutagenesis in the first extracellular loop between Pro331 and Phe332. Agilent QuikChangeII Site-Directed Mutagenesis kit together with the following primers were used: sense 5′ – GGTGATTGCCGAACGATCGGGGCCAGCGGTAC and antisense 5′ GTACCGCTGGCCCCGATCGTTCGGCAATCACC. The product was digested with PvuI (Thermo Scientific), and RSYPYDVPDYA RS (Hemaglutinin flanked by PvuI sites) was inserted through ligation (Phusion Hot Start II, ThermoFisher). Structure of the construct was verified by using BigDye® Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems). pGβ-2A-YFP-Gγ2-IRES-GαqmTq [16 (link)] was kindly provided by the lab of Th. W. J. Gadella and used for Gαq-Gβγ FRET (Förster Resonance Energy Transfer) measurements.
Bradykinin
Manufactured by Abcam
Sourced in United States
Bradykinin is a polypeptide that plays a role in the inflammatory response. It is a vasodilator and increases vascular permeability. Bradykinin is involved in the regulation of blood pressure, pain perception, and other physiological processes.
Automatically generated - may contain errors
Lab products found in correlation
Agilent quikchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions)
3 5 bis trifluoromethyl pyrazole btp2, by Santa Cruz Biotechnology (1 mentions)
Phusion hot start 2, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Dp controller 1 2 1108, by Olympus (1 mentions)
Wortmannin, by Santa Cruz Biotechnology (1 mentions)
L nio, by Enzo Life Sciences (1 mentions)
Calcium green 1 am, by Thermo Fisher Scientific (1 mentions)
L arginine, by Merck Group (1 mentions)
Foetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Protease inhibitor tablet, by Roche (1 mentions)
3 protocols using bradykinin
1
Characterization of AT1R Signaling
2
Measurement of Intracellular Calcium Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
[Ca2+] in the ER or cytosol was determined using G-CEPIA1er or GCaMP6f. Then 28 hr after transfection, Ca2+ imaging was performed with a fluorescence stereomicroscope (Olympus IX-71-22TFL/PH) and acquisition software (DP Controller 1.2.1.108). Fluorescence intensities were measured using ImageJ (https://imagej.nih.gov/ij/ ). After extracting the green channel, subtracting the background (rolling ball radius: 50.0 pixels), and applying threshold, average gray value of whole cells in each image was determined. Bradykinin, 4CmC, and CDN1163 were obtained from Abcam, Tokyo Chemical Industry, and Sigma-Aldrich, respectively.
3
Comprehensive Cell Culture Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dulbecco's modi ed Eagle's medium (DMEM) is purchased from PAN Biotech and Foetal Bovine Serum (FBS) from Invitrogen Life Technologies (Gaithersburg, MD). Human recombinant leptin, Bradykinin, Phenylmethylsulfonyal uoride (PMSF), Picoll, 5Fluorouracil (5FU), 5-Chloromethyl ouorescein diacetate (CMFDA), and all the primary antibodies are purchased from Abcam, USA. Propidium Iodide (PI), L-NAME, L-Arginine, 4',6-diamidino-2-phenylindole dihydrochloride (DAPI), recombinant VEGF were from Sigma Chemical Co (St. Louis, MO). L-NIO is purchased from Enzo life sciences and Wortmannin from Santa Cruz Biotechnologies. Collagen type-1 purchased from Pan Biotech GmbH Am Gewerbeperk. DAF-FM (4 amino-5-methylamino-2'7'di uoroscein) and Calcium green1/AM were from Molecular probes, Eugene, Oregon, USA. Protease inhibitor tablets from Roche Diagnostics. All the primary antibodies are purchased from Abcam, and all the secondary antibodies and DAB systems are purchased from Bangalore Gene, India. All the other chemicals are at least of the reagent grade and are obtained commercially.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!