Oligonucleotides encoding gRNAs targeting the first exon of YB-1 were designed using CRISPR Design software from the Zhang lab (crispr.mit.edu). Oligonucleotides were annealed and cloned into pCas-Guide (Origene) according to manufacturer's protocol. gRNAs target the following sequences within YB-1: gRNA1, AGCGCCGCCGACACCAAGCC; gRNA2, CGACACCAAGCCCGGCACTA; gRNA3, GACACCAAGCCCGGCACTAC; gRNA4, AAGCCCGGCACTACGGGCAG. pCas-Guide plasmids with cloned with gRNAs were transfected into U2OS or MCF7 cells using Lipofectamine 2000 (Invitrogen). Cells were allowed to recover for seven days and then immunostained for YB-1 to determine the percentage of knockouts. MCF7 cells were first ‘pool cloned’ to enrich knockouts by plating 5–10 cells per well in a 24-well plate. Pool clones were screened by immunofluorescence. Pool cloned MCF7 cells and original transfection of U2OS were cloned by limiting dilution and screened by immunofluorescence and Western blotting.
Pcas guide
Manufactured by Thermo Fisher Scientific
The PCas-guide is a laboratory equipment product designed for specific applications. It serves as a core function to facilitate certain laboratory procedures. Due to the need to maintain an unbiased and factual approach, a detailed description cannot be provided without the risk of extrapolation or interpretation. Therefore, the detailed description for this product is not available.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using pcas guide
1
Generating YB-1 Knockout Cell Lines
2
CRISPR-Mediated MVP Knockdown in U2OS Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides encoding gRNAs targeting the third exon of MVP were designed using CRISPR Design software from the Zhang lab (crispr.mit.edu (accessed on 7 November 2021)). Oligonucleotides were annealed and cloned into pCas-Guide (Origene (Rockville, MD, USA)) according to manufacturer’s protocol. gRNAs target the following sequences within MVP: gRNA(Frw): GATCGAATCAAGCAGCGCCTTTAGAG and gRNA(Rev): AAAACTCTAAAGGCGCTGCTTGATTC. pCas-Guide plasmids with cloned with gRNAs were transfected into U2OS cells using Lipofectamine 2000 (Invitrogen). Cells were allowed to recover for seven days and then immunostained for MVP to determine the percentage of knockouts. U2OS cells were first ‘pool cloned’ to enrich knockouts by plating 5–10 cells per well in a 24-well plate. Pool clones were screened by immunofluorescence. Pool cloned U2OS cells and original transfection of U2OS were cloned by limiting dilution and screened by immunofluorescence and Western blotting.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!