Instagene matrix genomic dna kit

In brief, fungal DNAs have been extracted using the InstaGeneTM Matrix Genomic DNA Kit (Bio-Rad Laboratories, Hercules, CA, USA) according to its manufacturer’s guidelines. A PCR assay of fungal 18s rRNA genes was performed using a DNA template and a couple of primers, NS1 F (5’ GTAGTCATATGCTTGTCTC 3’) and NS8 R (5’ TCCGCAGGTTCACCTACGGA 3’).63 The PCR reaction mixture consists of: 10X Taq PCR Buffer, 2 µL; 2.5 mM dNTP mixture, 1.6 µL; F and R primers (10 pmol/µL), 1.0 µL; KOMA Taq (2.5 U/µL), 0.2 µL; DNA template (20 ng/µL), 2 µL; and HPLC-grade distilled water to adjust the reaction volume to 20 µL. The amplification reactions were achieved in 20 µL using 1 µL of DNA template. The PCR was done as follows: initial denaturation was at 95 °C for 5 min, then 30 cycles including denaturation at 95 °C for 30s, annealing at 55 °C for 2 min, and extension at 68 °C for 1.5 min and a final extension at 68 °C for 10 minutes. The PCR products were confirmed using electrophoresis. Then, PCR purification was applied using the Montage PCR Cleanup Kit (MilliporeSigma, Burlington, MA, USA).

Genomic DNA was extracted from fungal and bacterial isolates using the InstaGene^TM Matrix Genomic DNA Kit (Bio-Rad Laboratories, Hercules, CA, USA) following the manufacturer’s instructions.