The largest database of trusted experimental protocols

Penicillin and streptomycin

Manufactured by Biosharp
Sourced in China, United States

Penicillin and streptomycin are antibiotics commonly used in laboratory settings. Penicillin is a beta-lactam antibiotic that inhibits bacterial cell wall synthesis, while streptomycin is an aminoglycoside antibiotic that disrupts protein synthesis in bacteria. These antibiotics are often used in cell culture and microbiology experiments to prevent bacterial contamination.

Automatically generated - may contain errors

6 protocols using penicillin and streptomycin

1

Cell culture conditions for NSCLC lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human NSCLC lines (A549, H1299, and PC9) and bronchial epithelial cells (HBE) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). HBE, H1299 and PC9 cells were cultured in RPMI 1640 medium (Gibco, USA) with 10% fetal bovine serum (ExCell, USA) and 1% penicillin and streptomycin (Biosharp, China). A549 cells were cultured in DMEM/F12 medium (Meilunbio, China) containing 10% fetal bovine serum (ExCell) and 1% penicillin and streptomycin (Biosharp). All the cells were cultured at 37℃ in a humidified atmosphere with 5% CO2. All the cells used in this study were tested negative for mycoplasma.
+ Open protocol
+ Expand
2

Culturing Cell Lines for Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
NIH/3T3 and 293T cells were cultured in DMEM (CGM101.05; CellMax, Lanzhou, China). JEG3 cells were cultured in EMEM (11700; Cary, Huzhou, China). HTR8/SVneo cells and Ishikawa cells were cultured in RPMI medium (C11875500BT; Thermo Fisher Biochemical, China). Cells were cultured at 37°C in a 5% CO2 atmosphere, and all culture media were supplemented with 100 U/ml penicillin and streptomycin (BL505A; Biosharp, Beijing, China) and 10% foetal bovine serum (CellMax, Lanzhou, China).
KRT18 antibody was purchased from Novus Biologicals (NPB2-67370; Littleton, CO, USA). Phalloidin was purchased from Thermo Fisher Scientific (A22284; USA). KRT18 fusion protein (Ag1260) and E-cadherin fusion protein (Ag15085) were purchased from Proteintech (Wuhan, Hubei, P.R.C.).
+ Open protocol
+ Expand
3

Cultured Cell Lines with qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
HPDE6-C7 (EK-Bioscience Inc., STR-Identified, Shanghai, China), Patu-8988 (iCell Bioscience Inc., STR-Identified, Shanghai, China) and PNAC-1 cells (Procell Inc., STR-Identified, Wuhan, China) were cultured in DMEM (Procell, China) supplemented with 10% fetal calf serum (Gibco, USA) and 1% penicillin and streptomycin (Biosharp, China) at 37 °C in 5% CO2. In qRT-PCR studies, the total RNA was extracted from cells. The primers were as follows: MBOAT2-fw: gcccatcgaccaggtatgc; MBOAT2-rv: cagcgagctgctccattttc; CDA-fw: caattgctatcgccagtgaca; CDA-rv: ccatccggcttggtcatgta; LPCAT2-fw: cctctggttggcagactgtt; LPCAT2-rv: tcacagtatcctggggccat; B4GALT5-fw: ctcgctgctgtacttcgtct; B4GALT5-rv: taaggatcgccaccttccac.
+ Open protocol
+ Expand
4

Endothelium Viability Assessed by CCK-8 Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
C166, a mouse vascular endothelial cell line used in this study, was purchased from Honsun Biological Technology Co., Ltd. (Shanghai, China). RAW264.7 cell line was provided by Professor Zhang Luo. C166 cells and RAW264.7 cells were cultured with DMEM (HycloneTM, USA) containing 10%FBS (Sigma, USA) and 1% antibiotics (penicillin and streptomycin; Biosharp, China) at 37 °C in a 5%CO2 incubator.
CCK‐8 assay was used to determine endothelium viability (MCE, USA). Briefly, C166 cells were seeded in a 96‐well plate at 5 × 103 cells·well−1 and treated with LPS at different doses and time points. Then CCK‐8 was added into the culture medium for 3 h and the absorbance at 450 nm was determined by a microplate reader. Cell viability was calculated according to the manufacturer's protocols.
+ Open protocol
+ Expand
5

Macrophage Cytotoxicity Assay with SGR Extracts

Check if the same lab product or an alternative is used in the 5 most similar protocols
RAW264.7 macrophages were obtained from the Department of Pharmacology of Traditional Chinese Medicines, China Pharmaceutical University (Nanjing, China), and were cultured in Dulbecco’s modified essential medium (DMEM, Gibco) containing 10% fetal bovine serum (FBS, Sigma–Aldrich) and penicillin and streptomycin (Biosharp) at 37 °C in a humidified 5% CO2 incubator (3111 type, Thermo Fisher Scientific). Cells were seeded in a 96-well culture plate at a density of 10 × 105 cells/well and allowed to attach at 37 °C for 24 h [33 ]. Cells were treated with SGR extracts (final concentration, low (L), medium (M) and high (H) dose of 0.53, 1.06, and 2.13 mg/mL, respectively) and LPS (final concentration, 1 µg/mL) for an additional 24 h. The formazan crystals were dissolved in 150 µL of dimethyl sulfoxide (DMSO) for 15 min, and the absorbance was detected at 570 nm.
+ Open protocol
+ Expand
6

Cell Culture Conditions for HEK-293T, Cal27, and UM1

Check if the same lab product or an alternative is used in the 5 most similar protocols
The SV40-transformed human embryonic kidney cell line HEK-293T, as well as HNSCC cell line Cal27, were purchased from Procell and cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Biology industry, Shanghai, China) and 1% penicillin and streptomycin (Biosharp, Shanghai, China). The human head and neck squamous cell line UM1 was a generous gift from Prof. Anxun Wang (Department of Oral and Maxillofacial Surgery, First Affiliated Hospital, Sun Yat-Sen University, Guangzhou, China) [75 (link),76 (link),77 (link),78 (link)], and cultured in DMEM/F12 medium (Hyclone, UT, USA) supplemented with 5% FBS and 1% penicillin and streptomycin. Cell culture was carried out at 37 °C, 5% CO2 and 95% humidity.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!