Powergen homogenizer

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PowerGen homogenizer is a laboratory equipment designed for sample preparation. It is used to efficiently homogenize a variety of sample types, including tissues, cells, and other biological materials, to create a uniform suspension for downstream analysis.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (1 mentions) Realplex machine, by Eppendorf (1 mentions) Chloramine t, by Merck Group (1 mentions) Purified hydroxyproline, by Merck Group (1 mentions) Complete protease inhibitors cocktail, by Merck Group (1 mentions) Bradford protein assay, by Bio-Rad (1 mentions) Uplc q tof ms system, by Waters Corporation (1 mentions) Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

PowerGen 125 homogenizer (20 citations) PowerGen 1000 Homogenizer (5 citations) Omni PowerGen Homogenizer (2 citations) High Viscosity Homogenizer PowerGen 1000 S1 (2 citations) PowerGen 125 rotor stator homogenizer (2 citations) Powergen High Throughput Homogenizer (2 citations)

7 protocols using powergen homogenizer

RNA Extraction and qRT-PCR Analysis of Tissue Samples

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For tissue culture cells, RNA was isolated using E.Z.N.A total RNA kit (Omega). For xenograft and mouse models, explanted tissue samples were grounded in 1000μl Trizol (Invitrogen) using a PowerGen homogenizer (Fisher Scientific), followed by addition of 200μl chloroform. The samples were then centrifuged at 10,000g for 15 min. The upper phase was mixed with an equal volume of 70% ethanol, and the RNA was further purified using E.Z.N.A total RNA kit (Omega).
For qRT-PCR, RNA was reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (ABI) and PCR was run using Power SYBR Master Mix (ABI) on a Realplex machine (Eppendorf). Expression was normalized to the ribosomal protein RPL27. The following primer pairs were used(21 (link)):
ETV1-Exon67: F: CTACCCCATGGACCACAGATTT, R: CTTAAAGCCTTGTGGTGGGAAG;
KIT: F: GGGATTTTCTCTGCGTTCTG, R: GATGGATGGATGGTGGAGAC;
DUSP6: F: TGCCGGGCGTTCTACCTGGA, R: GGCGAGCTGCTGCTACACGA
RPL27: F: CATGGGCAAGAAGAAGATCG, R: TCCAAGGGGATATCCACAGA;

Ran L., Sirota I., Cao Z., Murphy D., Chen Y., Shukla S., Xie Y., Kaufmann M.C., Gao D., Zhu S., Rossi F., Wongvipat J., Taguchi T., Tap W.D., Mellinghoff I.K., Besmer P., Antonescu C.R., Chen Y, & Chi P. (2015). Combined inhibition of MAP kinase and KIT signaling synergistically destabilizes ETV1 and suppresses GIST tumour growth. Cancer discovery, 5(3), 304-315.

+ Open protocol

+ Expand

Hepatic Hydroxyproline Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Liver tissue was homogenized in ice-cold distilled water (900 μl) using a Power Gen homogenizer (Fisher). Subsequently, 125 μl of 50% (wt/vol) trichloroacetic acid was added, and the homogenates were incubated further on ice for 20 min. Precipitated pellets were hydrolyzed for 18 h at 110°C in 6 N HCL. After hydrolysis, the samples were filtered and neutralized with 10 N NaOH, and the hydrolysates were oxidized with Chloramine-T (Sigma) for 25 min at room temperature. The reaction mixture then was incubated in Ehrlich’s perchloric acid solution at 65°C for 20 min and cooled to room temperature. Sample absorbance was measured at 560 nm in duplicate. Purified hydroxyproline (Sigma) was used to set a standard. Hydroxyproline content was expressed as microgram of hydroxyproline per g liver.

WANG F., LIU S., DU T., CHEN H., LI Z, & YAN J. (2014). NF-κB inhibition alleviates carbon tetrachloride-induced liver fibrosis via suppression of activated hepatic stellate cells. Experimental and Therapeutic Medicine, 8(1), 95-99.

+ Open protocol

+ Expand

Placental Homogenate Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

To prepare placental homogenates, placental tissues were washed four times in ice-cold PBS to remove remaining blood. After this, 2 g of tissue was placed into a homogenate plastic tube containing 10 mL of ice-cold PBS and protease inhibitors (complete protease inhibitors cocktail; Sigma-Aldrich, St. Louis, MO, USA). The tissue was fully homogenized with a Powergen homogenizer (Fisher Scientific, Pittsburg, PA, USA) for 30 seconds on ice. Homogenates were centrifuged at 12000 g for 20 min at 4°C. The supernatant was collected, filtered through a 0.22 μm Millipore membrane, and aliquots were stored at –80°C, until required for cytokine and angiogenic factor determination.

Weel I.C., Baergen R.N., Romão-Veiga M., Borges V.T., Ribeiro V.R., Witkin S.S., Bannwart-Castro C., Peraçoli J.C., De Oliveira L, & Peraçoli M.T. (2016). Association between Placental Lesions, Cytokines and Angiogenic Factors in Pregnant Women with Preeclampsia. PLoS ONE, 11(6), e0157584.

+ Open protocol

+ Expand

Measuring Tumor Growth and Angiogenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Log phase growing tumor cells (5–10 x 10⁶ cells/mouse, depending on the cell line) were implanted subcutaneously in athymic nude mice. When the average tumor size reached the indicated size, mice were randomly divided into groups and administered vehicle (5% DMSO/ 95% PEG-300) or test compounds by oral gavage. Tumor volumes were measured twice per week using digital calipers and body weights once per week. Tumor volume was determined according to the formula: L x (W)²/2, where L is the longest dimension and W is the shortest dimension.
At the end of experiments, the tumors were excised from mice and homogenized on ice using a Powergen homogenizer fitted with Omni-Tip disposable/reusable probes (both from Fisher Scientific) in Tris-HCl buffer containing a cocktail of proteinase inhibitors. Intra-tumor human VEGF levels, as well as levels of other growth factors or proteins, were subsequently measured using commercially available ELISA kits (R&D Systems). Protein concentrations of the homogenates were determined using the Bradford protein assay (Bio-Rad) and intratumor growth factor levels were normalized to the total protein concentration.

Cao L., Weetall M., Bombard J., Qi H., Arasu T., Lennox W., Hedrick J., Sheedy J., Risher N., Brooks P.C., Trifillis P., Trotta C., Moon Y.C., Babiak J., Almstead N.G., Colacino J.M., Davis T.W, & Peltz S.W. (2016). Discovery of Novel Small Molecule Inhibitors of VEGF Expression in Tumor Cells Using a Cell-Based High Throughput Screening Platform. PLoS ONE, 11(12), e0168366.

+ Open protocol

+ Expand

Tissue-specific Vitamin K Levels

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood was drawn from the vena cava after mice were anesthetized in a bell jar atmosphere containing isoflurane. Serum was immediately separated and analyzed or stored at −80°C until use. Blood chemistries (cholesterol, triglycerides, AST, ALT, ALP, nonesterified fatty acids, etc.) were measured in the Metabolic Phenotyping Core Facility at UT Southwestern Medical Center.
MK-4 levels in mouse tissues was measured as follows. Approximately 100 mg of tissue from Ubiad1^+/+: :Hmgcr^Ki/Ki and Ubiad1^-/-: :Hmgcr^Ki/Ki mice was homogenized in phosphate-buffered saline (PBS) using a Powergen homogenizer (Fisher Scientific). The internal standard, vitamin K₁₍₂₅₎, was added to homogenates generated from the kidney, pancreas, and spleen. The concentration of MK-4 in these homogenates was subsequently determined by reverse-phase HPLC as described previously (Booth et al., 2008 (link)) using a C30 column that allows improved resolution. The MK-4 content of the liver, brain, and adipose tissue was determined as described (Fu et al., 2009 (link); Harshman et al., 2016 (link)) by LC-MS using deuterium-labeled vitamin K₁ as an internal standard.
The histological analysis of tissues from Ubiad1^+/+: :Hmgcr^Ki/Ki and Ubiad1^-/-: :Hmgcr^Ki/Ki mice was conducted by the Pathology Core at UT Southwestern Medical Center.

Jo Y., Kim S.S., Garland K., Fuentes I., DiCarlo L.M., Ellis J.L., Fu X., Booth S.L., Evers B.M, & DeBose-Boyd R.A. (2020). Enhanced ER-associated degradation of HMG CoA reductase causes embryonic lethality associated with Ubiad1 deficiency. eLife, 9, e54841.

+ Open protocol

+ Expand

Metabolite Analysis Across Biological Matrices

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The methods for metabolite analysis in the liver, urine, feces and serum have been reported in previous papers.^{14 (link), 15} Briefly, urinary samples were prepared by mixing 40 μL of urine with 160 μL acetonitrile followed by centrifugation at 15,000 rpm for 10 min. Feces were homogenized in water (100 mg feces in 1 mL water). Two hundred microliters of acetonitrile was added to 100 μL of the resulting suspension, and vortexed for 1 min. Subsequently, the resulting mixture was centrifuged at 15,000 rpm for 10 min. Twenty microliters of serum sample was vortexed with 80 μL methanol for 1 min followed by centrifugation at 15,000 rpm for 10 min. Liver samples were homogenized in water (50 mg tissue in 200 μL water) using PowerGen homogenizer (Fisher Scientific, Waltham, MA), and then 200 μL of methanol was added to 100 μL of the liver homogenate. The resulting mixtures were vortexed for 1 min, and centrifuged at 15,000 rpm for 10 min. Each supernatant from all samples mentioned above was transferred to an auto sampler vial, and injected into the UPLC-QTOFMS system (Waters, Milford, MA) for metabolite analysis.

Zhu J., Wang P., Shehu A.I., Lu J., Bi H, & Ma X. (2018). Identification of novel pathways in idelalisib metabolism and bioactivation. Chemical research in toxicology, 31(7), 548-555.

+ Open protocol

+ Expand

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

To isolate RNA from cell lines, E.Z.N.A total RNA kit (Omega) was used. To isolate RNA from xenograft tumor explants, the tumor samples were ground in 1 ml Trizol (Invitogen) using a PowerGen homogenizer (Fisher Scientific), followed by the addition of 200 μL chloroform. The samples were then centrifuged at 10,000 g for 15 minutes. The upper phase was mixed with an equal volume of 70% ethanol, and the RNA was further purified using the E.Z.N.A total RNA kit (Omega). For qRT-PCR, RNA was reverse transcribed using the High-Capacity CDNA Reverse Transcription Lit (ABI). Power SYBR Master Mix (ABI) was used to run PCR on a ViiA7 Real Time PCR System (Life Technologies).

Shukla S., Cyrta J., Murphy D.A., Walczak E.G., Ran L., Agrawal P., Xie Y., Chen Y., Wang S., Zhan Y., Li D., Wong W.P., Sboner A., Beltran H., Mosquera J.M., Sher J., Cao Z., Wongvipat J., Koche R.P., Gopalan A., Zheng D., Rubin M.A., Scher H.I., Chi P, & Chen Y. (2017). Aberrant activation of a gastrointestinal transcriptional circuit in prostate cancer mediates castration resistance. Cancer cell, 32(6), 792-806.e7.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!