The largest database of trusted experimental protocols

E gel imager system with uv light base

Manufactured by Thermo Fisher Scientific

The E-Gel Imager System with UV Light Base is a compact and versatile imaging system designed for visualizing and documenting nucleic acid gels. It features a UV light base that provides uniform illumination for gel imaging. The system is capable of capturing images of agarose and polyacrylamide gels stained with various nucleic acid dyes.

Automatically generated - may contain errors

2 protocols using e gel imager system with uv light base

1

TMPRSS6 Genotyping by TaqMan Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted from 3 ml whole blood on EDTA by a commercial DNA extraction kit according to manufacturer’s protocol (QIAamp DNA Blood Mini kit, QIAGEN, USA) CAT No.51104. DNA integrity was determined by 1% agarose gel electrophoresis, stained with ethidium bromide, and visualized through GEL documentation (E-Gel- Imager System with UV Light Base, Thermo Scientific). DNA concentration was determined by Nano Drop 2000 Spectrophotometer (Thermo scientific). TMPRSS6 genotyping polymorphisms

rs4820268: CCTACCTTCCTGGCACTGCTCTTC [A/G] TCGCTGCCGTTGAGACAATCAGGCT,

rs855791: GCGTGGCGTCACCTGGTAGCGATAG [A/G] CCTCGCTGCACAGGTCCTGTGGGAT

rs11704654: CCTCACAGGCCTTGAACATCCCCTC[C/T] GGCTCCGCTTCCTCGCCATCACCTC

were performed using the TaqMan genotyping protocol (Applied Biosystems, Foster City, CA, USA). PCR reactions were set up in 20 μl reaction volume including 20–30 ng DNA, 10 μl TaqMan genotyping PCR Master Mix and 1 μl TaqMan SNP genotyping assay. The PCR assay was carried out according to manufacturer's instructions including one step of 10 min at 95 °C followed by 40 cycles of DNA denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min using the Rotor Gene Q real-time PCR (QIAGEN, Germany). Final products were analyzed by Rotor Gene software (Shinta et al.,) [22 (link)].
+ Open protocol
+ Expand
2

PPAR-γ Pro12Ala Genotyping Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA was extracted using QIAamp DNA Blood Mini Kits-50-Catalog no. 51104 supplied by QIAGEN. DNA integrity was determined by 1% agarose gel electrophoresis, stained with ethidium bromide, and visualized through GEL documentation (E-Gel® Imager System with UV Light Base, Thermo scientific). DNA concentration was determined by NanoDrop 2000 Spectrophotometer (Thermo scientific). PPAR-γ Pro12Ala polymorphisms (rs1801282) were detected by Real-Time polymerase chain reactions (PCR) using the Quantistudio 12 Flex real-time PCR system (Applied Biosystems, CA 94404, USA). PPAR-γ Pro12Ala polymorphisms (rs1801282): (Applied BiosystemsID: C_1129864_10) allele discrimination was performed using the TaqMan® genotyping protocol (Applied Biosystems, Foster City, CA, USA). PCR reactions were set up in 20 μl reaction volume including 20–30 ng DNA and 10 μl TaqMan® Universal PCR Master Mix in 96-well PCR plates. The PCR assay was carried out according to manufacturer's instructions including one step of 10 min at 95 °C followed by 40 cycles of DNA denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. Final products were analyzed by TaqMan Genotyper software.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!