The largest database of trusted experimental protocols

8 protocols using ai9 tdtomato

1

Investigating GABAergic Neurons in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Experiments were performed with adult male (6–12-week-old) wild-type (WT) C57BL/6J (purchased from the Laboratory Animal Center of the Fourth Military Medical University), GAD2-Cre (JAX#010802), Ai9-TdTomato (JAX#007909) mice (purchased from Jackson Laboratories) and GAD67-GFP. About 200 mice were used in the study, and the number of the mice per subgroups is described in the figure legends. All animals used were housed in a 12 h light/dark cycle at 22–25 °C with food and water given ad libitum. Animal care and used strictly followed institutional guidelines and governmental regulations. All protocols to reduce the suffer of the animal from surgical operation were performed in accordance with the Animal Care and Use Committees at The Fourth Military Medical University (NO: IACUC-20210356).
+ Open protocol
+ Expand
2

Genotyping GAD67-EGFP Transgenic Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
All animal experiments were conducted in accordance with the guidelines of the National Animal Ethic Committee of Denmark. C57BL/6J (Janvier Labs), PVCre (017320, Jackson Labs), Ai9-tdTomato (007905, Jackson Labs) and GAD67-EGFP (Gad1tm1.1Tama) [41 (link)] mice were used in this study. The mice were kept in IVC cages and housed under a reversed light cycle with food and water ad libitum. Heterozygous GAD67-EGFP mice were bred with wild-type mice. Females were kept with males until the vaginal plug was detected, and then males were separated. Date of the vaginal plug were treated as E0.5, and embryos and pups were timed accordingly. Pups were weaned at P21 and littermates of the same sex were kept separately at 3–6 animals per cage.
EGFP+ animals were identified by PCR using the Accustart II Polymerase (QuantaBio). PCR conditions used were: 94 °C for 2 min, followed by 35 cycles of 94 °C for 15 s, 62 °C for 30 s, 72 °C for 30 s, and final extension at 72 °C for 5 min. The following primers (in 5′–3′ orientation) amplified a 345 bp region.
EGFP_F CCTACGGCGTGCAGTGCTTCAGC
EGFP_R CGGCGAGCTGCACGCTGCGTCCTC
+ Open protocol
+ Expand
3

Transgenic Mouse Model Experiments

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mice were group-housed under a 12 h light/dark cycle, with food and water available ad libitum. Thy1-YFPH, PV-Cre, SST-Cre, VIP-Cre, and Ai9-tdTomato mice with C57BL/6 background were purchased from the Jackson Laboratory and housed in the Laboratory Animal Unit, The University of Hong Kong. Postnatal day 30 (P30) ± 1 mice were used in this study. Animals were randomly assigned to different experimental groups. All experiments were approved and performed in accordance with University of Hong Kong Committee on the Use of Live Animals in Teaching and Research guidelines.
+ Open protocol
+ Expand
4

Conditional Knockout of Sas-4 in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Sas-4 conditional allele was recently described 21 (link). In brief, knockout-first ES cell line (EPD0028_7_G05) was obtained from the International Knockout Mouse Consortium (Cenpjtm1a(EUCOMM)Wtsi) (http://www.knockoutmouse.org). Actin-FLP transgenic mice (JAX stock #005703) were used to excise the gene trap and obtain Sas-4+/fl (fl, floxed allele). Nestin-Cre (JAX stock #003771), Emx1-Cre (JAX stock #005628), Ai9/tdTomato (JAX stock #007909) mice were obtained from the Jackson Laboratory. Trp53ftm1Brn mice were a kind gift from David Solit at SKI (JAX stock #008462). The analysis was performed in a mixed FVB/NJ and C57BL6 mouse background. Genotyping was carried out using standard PCR protocols. All experiments were conducted in accordance with animal protocols approved by the Institutional Animal Care and Use Committee (IACUC).
+ Open protocol
+ Expand
5

ChAT-Cre/tdTomato Mouse Model Husbandry

Check if the same lab product or an alternative is used in the 5 most similar protocols
All animal procedures were approved by the Georgetown University Medical Center Institutional Animal Care and Use Committee (IACUC). ChAT-Cre (strain #031661) and Ai9/tdTomato (strain #007909) mice on the C57BL/6J background were purchased from Jackson Laboratory and crossed to produce ChAT-Cre/TdTomato mice. WT C57BL/6J (strain #000664) mice were purchased from Jackson Laboratory and bred in the Georgetown University Department of Comparative Medicine animal facility. Mice were group-housed with same-sex littermates when possible and had ad libitum access to food and water in a 12-hr light/12-hr dark cycle room.
+ Open protocol
+ Expand
6

Transgenic Mouse Models for CRF and VGLUT2 Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols
All experimental mice were male and female adult mice on a C57BL/6J background strain. Wild-type C57BL/6J mice were purchased as adults from Jackson Laboratory, and all transgenic lines were bred in our animal facility. CRF-ires-Cre (CRF-Cre)18 (link),39 (link) and VGLUT2-ires-Cre (VGLUT2-Cre)40 (link) mice were bred with WT C57BL/6J mice, and hemizygous CRF-Cre mice were bred with homozygous floxed Ai9-tdTomato or floxed EGFP-L10a mice purchased from Jackson Laboratory (stocks 007909 and 024750) to produce CRF-Cre-reporter mice. Mice were group-housed with ad libitum access to food and water in colony room on a 12:12 h reverse light cycle, with lights off at 7:30 a.m. Mice were singly housed for one week prior to the onset of behavioral experiments and remained singly housed thereafter. Experiments began approximately 3 h into the dark phase of the light cycle. All experimental procedures were approved by the Institutional Animal Care and Use Committees at Weill Cornell Medicine and the University of North Carolina-Chapel Hill.
+ Open protocol
+ Expand
7

Conditional Knockout of Sas-4 in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Sas-4 conditional allele was recently described 21 (link). In brief, knockout-first ES cell line (EPD0028_7_G05) was obtained from the International Knockout Mouse Consortium (Cenpjtm1a(EUCOMM)Wtsi) (http://www.knockoutmouse.org). Actin-FLP transgenic mice (JAX stock #005703) were used to excise the gene trap and obtain Sas-4+/fl (fl, floxed allele). Nestin-Cre (JAX stock #003771), Emx1-Cre (JAX stock #005628), Ai9/tdTomato (JAX stock #007909) mice were obtained from the Jackson Laboratory. Trp53ftm1Brn mice were a kind gift from David Solit at SKI (JAX stock #008462). The analysis was performed in a mixed FVB/NJ and C57BL6 mouse background. Genotyping was carried out using standard PCR protocols. All experiments were conducted in accordance with animal protocols approved by the Institutional Animal Care and Use Committee (IACUC).
+ Open protocol
+ Expand
8

Genetic Mouse Models for Stress Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
All experimental mice were male and female adult mice on a C57BL/6J background strain. Wild-type C57BL/6J mice were purchased as adults from Jackson Laboratory, and all transgenic lines were bred in our animal facility. CRF-ires-Cre (CRF-Cre) 15, (link)36 (link) and VGLUT2-ires-Cre (VGLUT2-Cre) 37 (link) mice were bred with WT C57BL/6J mice, and hemizygous CRF-Cre mice were bred with homozygous floxed Ai9-tdTomato or floxed EGFP-L10a mice purchased from Jackson Laboratory (stocks 007909 and 024750) to produce CRF-Cre-reporter mice. Mice were group housed with ad libitum access to food and water in colony room on a 12:12 hr reverse light cycle, with lights off at 7:30 a.m. Mice were singly housed for one week prior to the onset of behavioral experiments and remained singly housed thereafter. Experiments began approximately 3 hr into the dark phase of the light cycle. All experimental procedures were approved by the Institutional Animal Care and Use Committees at Weill Cornell Medicine and University of North Carolina-Chapel Hill.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!