Ai9 tdtomato

Experiments were performed with adult male (6–12-week-old) wild-type (WT) C57BL/6J (purchased from the Laboratory Animal Center of the Fourth Military Medical University), GAD2-Cre (JAX#010802), Ai9-TdTomato (JAX#007909) mice (purchased from Jackson Laboratories) and GAD67-GFP. About 200 mice were used in the study, and the number of the mice per subgroups is described in the figure legends. All animals used were housed in a 12 h light/dark cycle at 22–25 °C with food and water given ad libitum. Animal care and used strictly followed institutional guidelines and governmental regulations. All protocols to reduce the suffer of the animal from surgical operation were performed in accordance with the Animal Care and Use Committees at The Fourth Military Medical University (NO: IACUC-20210356).

All animal experiments were conducted in accordance with the guidelines of the National Animal Ethic Committee of Denmark. C57BL/6J (Janvier Labs), PV^Cre (017320, Jackson Labs), Ai9-tdTomato (007905, Jackson Labs) and GAD67-EGFP (Gad1^tm1.1Tama) [41 (link)] mice were used in this study. The mice were kept in IVC cages and housed under a reversed light cycle with food and water ad libitum. Heterozygous GAD67-EGFP mice were bred with wild-type mice. Females were kept with males until the vaginal plug was detected, and then males were separated. Date of the vaginal plug were treated as E0.5, and embryos and pups were timed accordingly. Pups were weaned at P21 and littermates of the same sex were kept separately at 3–6 animals per cage.
EGFP+ animals were identified by PCR using the Accustart II Polymerase (QuantaBio). PCR conditions used were: 94 °C for 2 min, followed by 35 cycles of 94 °C for 15 s, 62 °C for 30 s, 72 °C for 30 s, and final extension at 72 °C for 5 min. The following primers (in 5′–3′ orientation) amplified a 345 bp region.
EGFP_F CCTACGGCGTGCAGTGCTTCAGC
EGFP_R CGGCGAGCTGCACGCTGCGTCCTC

Mice were group-housed under a 12 h light/dark cycle, with food and water available ad libitum. Thy1-YFPH, PV-Cre, SST-Cre, VIP-Cre, and Ai9-tdTomato mice with C57BL/6 background were purchased from the Jackson Laboratory and housed in the Laboratory Animal Unit, The University of Hong Kong. Postnatal day 30 (P30) ± 1 mice were used in this study. Animals were randomly assigned to different experimental groups. All experiments were approved and performed in accordance with University of Hong Kong Committee on the Use of Live Animals in Teaching and Research guidelines.