Ai9 tdtomato
Ai9-tdTomato is a fluorescently labeled antibody conjugate produced by Jackson ImmunoResearch. It is designed for use in flow cytometry and microscopy applications.
Lab products found in correlation
8 protocols using ai9 tdtomato
Investigating GABAergic Neurons in Mice
Genotyping GAD67-EGFP Transgenic Mice
EGFP+ animals were identified by PCR using the Accustart II Polymerase (QuantaBio). PCR conditions used were: 94 °C for 2 min, followed by 35 cycles of 94 °C for 15 s, 62 °C for 30 s, 72 °C for 30 s, and final extension at 72 °C for 5 min. The following primers (in 5′–3′ orientation) amplified a 345 bp region.
EGFP_F CCTACGGCGTGCAGTGCTTCAGC
EGFP_R CGGCGAGCTGCACGCTGCGTCCTC
Transgenic Mouse Model Experiments
Conditional Knockout of Sas-4 in Mice
ChAT-Cre/tdTomato Mouse Model Husbandry
Transgenic Mouse Models for CRF and VGLUT2 Studies
Conditional Knockout of Sas-4 in Mice
Genetic Mouse Models for Stress Research
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!