Sections (6 μm) were prepared from formalin-fixed paraffin-embedded blocks for IHC stains with adequate controls. IHC was performed using the Avidin/Biotin blocking kit (Vector Labs, SP-2001) staining with antibodies against S100 (1:250 dilution; catalog ab41548, Abcam), KI-67 (prediluted; catalog 790-4286, Ventana), and COL4A (1:1000 dilution; catalog ab6586, Abcam) as previously described (49 (link)). Immunolabeling for anti-histone H3 (tri methyl K27) (1:200 dilution; catalog ab6002, Abcam) was performed on formalin-fixed, paraffin embedded sections. Briefly, following dewaxing and rehydration, slides were immersed in 1% tween-20; then, heat-induced antigen retrieval was performed in a steamer using 1.0 mM EDTA pH 9.0 (catalog AP9004500, Thermo Fisher Scientific) for 45 minutes. Slides were rinsed in PBST, and endogenous peroxidase and phosphatase was blocked (catalog S2003, Dako). Sections were then incubated with primary antibody anti–histone H3 (tri methyl K27) (1:200 dilution; catalog ab6002, Abcam) for overnight at 4°C. The primary antibodies were detected by 30-minute incubation with HRP-labeled secondary antibody (catalog PV6114, Leica Microsystems), followed by detection with 3,3′-Diaminobenzidine (Sigma-Aldrich), counterstaining with Harris hematoxylin, dehydration, and mounting.
Ab6002
Manufactured by Abcam
Sourced in United Kingdom, United States
Ab6002 is a lab equipment product. It serves as a core function for laboratory procedures.
Automatically generated - may contain errors
Lab products found in correlation
Ab8580, by Abcam (42 mentions)
Ab1791, by Abcam (39 mentions)
Ab4729, by Abcam (36 mentions)
Ab8898, by Abcam (33 mentions)
Ab1220, by Abcam (22 mentions)
Ab8895, by Abcam (14 mentions)
Ab9050, by Abcam (9 mentions)
Ab1012, by Abcam (8 mentions)
Ab24684, by Abcam (7 mentions)
Ab191250, by Abcam (7 mentions)
Ab10812, by Abcam (6 mentions)
Ab172730, by Abcam (6 mentions)
Anti ezh2, by Merck Group (6 mentions)
Sc 2025, by Santa Cruz Biotechnology (5 mentions)
Ab191080, by Abcam (5 mentions)
Formaldehyde, by Merck Group (5 mentions)
Qiaquick pcr purification kit, by Qiagen (5 mentions)
Ab3594, by Abcam (4 mentions)
Hiseq 2500, by Illumina (4 mentions)
Ab4441, by Abcam (4 mentions)
201 protocols using ab6002
1
Immunohistochemical Staining Protocol
2
ChIP-qPCR Analysis of EZH2 and H3K27me3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin was isolated from cells, cross-linked with 1% formaldehyde and incubated with specific antibodies to EZH2 (ab228697, dilution ratio of 1: 200, Abcam) and H3K27me3 (ab6002, dilution ratio of 1: 200, Abcam). IP was performed using magnetic protein G immunomagnetic beads (Dynabeads, Life Technologies), followed by elution with an elution buffer solution (100 mM NaHCO3, and 1% SDS) at 65°C. Quantification was conducted using non-specific primers of binding sites to EZH2 on the KLF4 promoter by means of RT-qPCR. Rabbit IgG was used as NC for primary antibody.
3
Histone Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Histone extraction and Western blot analyses were performed from 10 larvae as described previously [46 (link)].
Primary antibodies used were mouse anti-H3K27me3 (1:1000; ab6002, Abcam, Paris, France), rabbit anti-H3K27me2 (1:500; ab24684, Abcam), rabbit anti-H3K27me1 (1:500; ab84932, Abcam), rabbit anti-H2AK119ub (1:2000; DC27C4; Cell Signaling), rabbit anti-H3K9me3 (1:1000; AB8898; Millipore-Sigma Aldrich S.a.r.l., Saint-Quentin-Follavier, France), rabbit anti-H4K20me3 (1:1000; ab9053; Abcam), rabbit anti-H3K27ac (1:1000; ab4729; Abcam) and rabbit anti-H3 (1:5000; ab1791, Abcam). The secondary antibodies were peroxidase conjugated anti-mouse antibody (1:10,000; 115-035-003, Jackson ImmunoResearch, Ely, UK) and peroxidase conjugated anti-rabbit antibody (1:10,000; 711-035-152, Jackson ImmunoResearch).
Primary antibodies used were mouse anti-H3K27me3 (1:1000; ab6002, Abcam, Paris, France), rabbit anti-H3K27me2 (1:500; ab24684, Abcam), rabbit anti-H3K27me1 (1:500; ab84932, Abcam), rabbit anti-H2AK119ub (1:2000; DC27C4; Cell Signaling), rabbit anti-H3K9me3 (1:1000; AB8898; Millipore-Sigma Aldrich S.a.r.l., Saint-Quentin-Follavier, France), rabbit anti-H4K20me3 (1:1000; ab9053; Abcam), rabbit anti-H3K27ac (1:1000; ab4729; Abcam) and rabbit anti-H3 (1:5000; ab1791, Abcam). The secondary antibodies were peroxidase conjugated anti-mouse antibody (1:10,000; 115-035-003, Jackson ImmunoResearch, Ely, UK) and peroxidase conjugated anti-rabbit antibody (1:10,000; 711-035-152, Jackson ImmunoResearch).
4
Histone Extraction and Immunoblotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We prepared histones as described previously49 (link). Briefly, we lysed harvested HCT116, HT29 and DLD-1 cells after treatment of DMSO, 2 µM JIB-04, or 10 µM salinomycin for 24 h by mechanical shearing on a rotator in hypotonic lysis buffer at 4 °C. We extracted histones from the cell lysates with H2SO4 and precipitated them in TCA. After washing the precipitated histones with acetone, we dissolved the yields in distilled water.
We used the following antibodies for western blotting: anti-CD133 (Novus Biologicals, #NB120-16518), anti-E-cadherin (Cell signaling, #3195), anti-EpCAM (Cell signaling, #2929), anti-Vimentin (Cell signaling, #5741), anti-LGR5 (Novus Biologicals, #NBP1-28904), anti-CD44 (Santa Cruz Biotechnology, #sc-7297), anti-GAPDH (AbClon, #AbC-2003), anti-H3 (Abcam, #ab1791), anti-H3K9me2 (Abcam, #ab1220), anti-H3K9me3 (Millipore, #CS207324), anti-H3K36me3 (Abcam, #Ab9050), anti-H3K4me2 (Milipore, #07-030), and anti-H3K27me3 (Abcam, #Ab6002).
We used the following antibodies for western blotting: anti-CD133 (Novus Biologicals, #NB120-16518), anti-E-cadherin (Cell signaling, #3195), anti-EpCAM (Cell signaling, #2929), anti-Vimentin (Cell signaling, #5741), anti-LGR5 (Novus Biologicals, #NBP1-28904), anti-CD44 (Santa Cruz Biotechnology, #sc-7297), anti-GAPDH (AbClon, #AbC-2003), anti-H3 (Abcam, #ab1791), anti-H3K9me2 (Abcam, #ab1220), anti-H3K9me3 (Millipore, #CS207324), anti-H3K36me3 (Abcam, #Ab9050), anti-H3K4me2 (Milipore, #07-030), and anti-H3K27me3 (Abcam, #Ab6002).
5
ChIP-seq protocol for histone modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was conducted as described previously in50 (link). In brief, HSV-1 infected cells were fixed with 1% formaldehyde and sonicated to shear DNA. After centrifugation, the supernatants were incubated with anti-SRSF2 antibodies (Abcam, ab11826), anti-H3K4Me3 antibodies (Abcam, ab8580), anti-H3K27Me3 antibodies (Abcam, ab6002), anti-H3K27Ac antibodies (Abcam, ab4729), or anti-histone H3 antibodies (Abcam, ab1791). Chromatin DNA was purified by Dynabeads protein G (Invitrogen, 10004D) and subjected to real-time PCR. The region-specific primers are listed in Supplementary Table 1 .
6
ChIP-PCR Quantification of Histone Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP experiment was performed based on a previously published protocol [69 (link)]. Simply, 0.5 g of 3-day-old or four-leaf-old seedlings of Oschr4-5 and WT were first harvested and crosslinked in 1% formaldehyde under vacuum for 15 min or 30 min, respectively. Then the isolated chromatin complex was fragmented to 200–500 bp by sonication, and 1% of the fragmented chromatin from each tube was kept as input DNA. The chromatin modification states of several target genes were analyzed using antibodies recognizing H3K4me3 (ab8580, Abcam, Cambridge, UK) and H3K27me3 (ab6002, Abcam) and the pre-immune serum (02-6502, Invitrogen) as a negative control. Then the immune complexes were collected with Protein A Agarose beads (P3476, Sigma). After reversing the crosslink, the precipitated and input DNAs were detected by real-time PCR, and the enrichment of H3K4me3 and H3K27me3 of each genes was quantified by normalizing the threshold cycle (Ct) of the ChIP sample with that of the input with 2(Ct of input − Ct of sample ChIP). Specific primers used in ChIP-PCR are shown in Table S4 .
7
Antibody-based Protein Quantification in Cellular Studies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies for β-actin (sc-47778), COX2 (sc-19999), MMP1 (sc-21731), NRF1 (sc-101102), and SOD2 (sc-30080) were obtained from Santa Cruz Biotechnology. Antibodies for acetyl-histone H4 K5, K8, K12, and K16 (H4K5,8,12,16ac, #PA5-40084) were obtained from Invitrogen. Antibodies for anti-histone H3 acetyl K9, K14, K18, K23, K27 (H3K9, 14, 18, 23, 27ac, ab47915), ERα (ab3575), ERβ (ab3576), H4K20me1 (ab9051), H4K20me3 (ab9053), H4R3me1 (ab17339), H3K9me2 (ab1220), H3K9me3 (ab8898), H3K27me2 (ab24684) and H3K27me3 (ab6002), H2AX (ab20669), and γH2AX (ab2893) were obtained from Abcam. The antibody for 8-oxo-dG (4354-MC-050) was obtained from Novus Biologicals. The 3-nitrotyrosine (3-NT) was measured using 3-Nitrotyrosine ELISA Kit (ab116691 from Abcam) per manufacturers’ instructions. The mitochondrial fraction was isolated using a Pierce Mitochondria Isolation Kit (Pierce Biotechnology) according to manufacturers’ instructions. The protein concentration was measured using the Coomassie Protein Assay Kit (Pierce Biotechnology) per manufacturers’ instructions. Luciferase activity assay was carried out using the Dual-Luciferase™ Assay System (Promega) and the transfection efficiency was normalized using a cotransfected renilla plasmid (23 (link)). 17β-estradiol (E2, #E2758) and TNFα (#T0157) were obtained from Sigma.
8
ChIP-qPCR Analysis of H3K27me3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For chromatin shearing in lysates of cells transfected with small interfering RNA (siRNA) (siHERES or siControl), we used waterbath sonication for 30 cycles under cooling conditions, 15 s on, 30 s off (170–190 W). The fragmented chromatin was extracted using a High-Sensitivity ChIP kit (ab185913; Abcam), according to the manufacturer’s protocol. A total of 5 μg of total chromatin was used for ChIP with anti-H3K27me3 (ab6002; Abcam) and the mock immunoprecipitation (IP) (IgG, ab185913; Abcam) at 4 °C overnight. After cross-link reversal and DNA purification, 1 μL of eluted DNA was used for qRT-PCR with target region primers. The primer sequences for qRT-PCR are shown in Dataset S9 .
9
Cell Culture and Antibody Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells, L cells (an immortalized mouse fibroblast cell line), SW480 cells and HCT116 cells were obtained from Shanghai Life Academy of Sciences cell library (Shanghai, China). All cells were grown in DMEM medium (Invitrogen, Carlsbad, CA), and maintained in culture supplemented with 10% heat-inactivated fetal calf serum, 100 ug ml−1 of penicillin, and 100 μg ml−1 of streptomycin at 37 °C with 5% CO2 in a humidified incubator (Thermo, Waltham, MA). During the study, all cell cultures were periodically tested for mycoplasma by using MycoAlert Mycoplasma Detection Kit (Lonza, Rockland, ME). For western blot, antibodies specific for VGLL4 (1:500, ab140290), TEAD4 (1:500, ab58310), Histone H3 (1:1,000, ab6002) and β-catenin (1:1,000, ab2365) were purchased from Abcam (Cambridge, UK); those for FLAG (1:5,000, M4439) and α-tubulin (1:2,000, T6199) were from Sigma (St. Louis, MO); and those for TCF4 (1:500, sc-166699), c-Jun (1:1,000, sc-4113) and GST (1:1,000, sc-138) were bought from Santa Cruz Biotechnology (Santa Cruz, CA).
10
ChIP-qPCR Analysis of H3K27me3 at pri-miR-1275
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed based on the protocol from the manufacturer (17‐10086; Merck Millipore, Sigma‐Aldrich, St. Louis, MO, USA). Briefly, cells (1 × 107) were treated with 1% formaldehyde for 10 min to cross‐link the histones to the DNA. After sonication of cell pellets, the lysate was incubated with 10 μL of anti‐K27 tri‐methylated histone H3 (ab6002; Abcam). To collect the immunoprecipitated complexes, magnetic beads were added and incubated with the lysate overnight at 4 °C. After the cross‐linking was reversed, DNA was extracted and purified using the phenol/chloroform method, ethanol‐precipitated, and dissolved in water. ChIP products were assayed via SYBR Green ChIP‐qPCR using the following set of primers: (sense) GCAGAAATACCTCACCAAGTTTTTA and (antisense) TTTGGCATACTTACAGACACAAGAC, encompassing the pri‐miR‐1275 promoter region.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!