RNA samples were collected post-treatment by lysing the cells with triazol (Invitrogen) using manufacturer’s protocol. Isolated RNA was reverse transcribed with Superscript II reverse transcriptase (Invitrogen) using random primers and used for qRTPCR. RT-PCRs (25μl) contained 12.5μL of Platinum qPCR Supermix (Invitrogen), 0.125mM primer (IDT), 50 X SYBR Green (Invitrogen), and 1000 X Flourescein. All qRT-PCR was run on BioRad icycler for one cycle at 50°C for 2min and 95°C for 2min, and 30–50 cycles at 95°C for 10 s, and 68°C for 45 s. All standard curves had an R2 of at least 0.995, were composed of a minimum of 4 points, and were linear for at least 3 orders of magnitude. To avoid plateau effects, the Ct was always positioned in the logarithmic component of the sigmoid fluorescence curve. The Ct was selected based solely on the maximal linearity of standard curve. RT-PCR data were normalized to PPIA cDNA levels also detected by real-time PCR.
Triazol
Manufactured by Thermo Fisher Scientific
Sourced in United States
Triazol is a laboratory equipment product offered by Thermo Fisher Scientific. It is designed for use in various scientific and analytical applications. The core function of Triazol is to provide a reliable and efficient means of performing specific laboratory tasks. No further details can be provided while maintaining an unbiased and factual approach.
Automatically generated - may contain errors
Lab products found in correlation
Tetro cdna synthesis kit, by Meridian Bioscience (2 mentions)
Sybr green, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop one microvolume uv vis spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Icycler, by Bio-Rad (1 mentions)
Random primer, by Thermo Fisher Scientific (1 mentions)
7000 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Thermo Fisher Scientific (1 mentions)
Superscript 2, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Superscript vilo master mix, by Thermo Fisher Scientific (1 mentions)
Revertaid revert transcription kit, by Thermo Fisher Scientific (1 mentions)
Miniopticon real time pcr system, by Bio-Rad (1 mentions)
Cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr, by Thermo Fisher Scientific (1 mentions)
Dnase treatment, by Thermo Fisher Scientific (1 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Abi 7300 real time pcr machine, by Thermo Fisher Scientific (1 mentions)
16 protocols using triazol
1
Quantitative RT-PCR Analysis of Gene Expression
2
Quantitative Real-Time PCR for Lung Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We isolated RNA from the lungs via Triazol (Invitrogen) and treated it with DNase I (Invitrogen). We used random primers (Invitrogen) and Superscript II (Invitrogen) to synthesize first-strand complementary DNAs from equivalent amounts of RNA from each sample. We performed real-time RT-PCR in a 7000 Real-Time PCR System (Applied Biosystems) with SYBR Green PCR Master Mix (Applied Biosystems). Data were generated by the comparative threshold cycle (ΔCT) method by normalizing to HPRT [26 (link)]. Forward and reverse primers amplifying are as follows, respectively:
M2 :5′GAGGTCGAAACG CCT 3′ & 5′CTGTTCCTTTCGATATTCTTCCC3′, CYP4F18: 5′ AGAGCCTGGTGCGAACCTT 3′ & 5’ TGGAATATGCGGATGACTGG 3’, CYP4F16: 5’GGAGTGGCTTCCTGGATTTT3’& 5’ATGCAGGGTCAACAATCCTC3’, TBXAS1: 5’AGGCTTCTGAAAGAGGTGGACCT3′ & 5′TGAAATCACCATGTCCAGATAC3′, ALOX5: 5′ATGCCCTCCTACACTGTCAC3′ & 5′CCACTCCATCCATCTATACT3′, ALOX5ap: 5’CTCCCAGATAGCCGACAAAG3’ & 5’CAGAACTGCGTAGATGCGTA3’, COTL1: 5’GATGAGGGCAAACTTGGATCT3’ & 5’GAGCAGATTACCAGCACTTCA3’, GGGT1: 5’AGGAGAGACGGTGACT3' & 5' GGCATAGGCAAACCGA3', DPEP2: 5’CTGACCTTTCTCTGCCACA3’ &5’GAATCTTCCTGATGACCTCCTG3’
3
RNA Extraction and Quantification in Mouse and Human Brains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse brain samples were aliquoted from chopped and mixed brains. Human cortex brain tissues were obtained from Banner Sun Health Research Institute. The evaluation from our Institutional Review Board determined that research with these coded tissues without identifiers from deceased subjects do not meet the definition of human subject research. Total RNAs were extracted using TRIazol (Invitrogen, 15596018). 1 µg of RNA was reverse transcribed into cDNA using the Tetro cDNA synthesis kit (Bioline, BIO‐65043). Real‐time PCR was performed using DyNAmo Flash SYBR Green qPCR mix on a StepOnePlus system (Applied Biosciences). Human‐specific ASPA primers (forward: 5′‐CAC TAC CCT GCT ACG TTT ATC TG‐3′ and reverse: 5′‐GGA TAC TTG GCT ATG GAA CGA G‐3') were designed and evaluated in mouse and human brains. The β‐actin primers (forward: 5′‐GGC TTC GCG GGC GAC GAT GC‐3′ and reverse: 5′‐CTC TCT TGC TCT GGG CCT CGT C‐3') that are good for both mouse and human were designed, and the PCR product of β‐actin was used as the loading control.
4
RNA Extraction from Left Atrial Tissue
5
RNA Extraction from Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ten milliliters of Triazol (Invitrogen, USA) was added to treated DU145 and PC3 flasks and incubated at 25°C for 5min. Chloroform (400 µL) was added and centrifuged (g ×12000) at 4°C. The aqueous layer was mixed with 500 µL isopropanol and recentrifuged. Ethanol (70°C) was added to precipitated RNA and centrifuged (g ×7500) at 4°C. The extracted RNA was dissolved in diethylpyrocarbonate water.
6
Quantifying Gene Expression in Arabidopsis and Nicotiana
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify BAM1 expression or TMV RNA levels in Arabidopsis, about 50 mg of upper, non-inoculated leaves were harvested at 6 and 13 dpi. Total RNA was extracted by Triazol (#15596026, Invitrogen) according to the manufacturer’s instructions and utilized as template to synthesize cDNA using the RevertAid Revert Transcription Kit (#K1691,Thermofisher) and hexa-random primers. Quantitative PCR (qPCR) was performed using the EvaGreen Dye protocol as recommended by the manufacturer (#31000, Gold Biotechnology) in a MiniOpticon real-time PCR system (#CFB-3120, Bio-Rad). Arabidopsis ACTIN 2 (AT3G18780) was used as an internal control for normalization. To quantify NbBAM1 expression in the TRV-silenced N. benthamiana plants, we utilized the same protocol, except that the RNA was derived from 100 mg samples of the upper, non-inoculated leaves collected at day 14 after TRV treatment. N. benthamiana PP2A was used as an internal control for normalization51 (link). Primers used for these qPCR reactions are listed in Table S1 . Fold change was calculated by delta-delta Ct method as described52 (link).
7
Renal Tissue Analysis of Inflammatory Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs from renal tissues were isolated using Triazol (Invitrogen). A Nano-Drop 2000c (Thermo Scientific, Germany was used to determine the concentration and purity of RNA samples). Following the manufacturer’s instructions, complementary DNA was generated from 1g/L RNA samples using the cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). QRT-PCR was performed using the primers of toll-like receptors and NF-KB pathway (NF-KB, IL-6, TNF, TLR2, TLR4, Nrf2, and Keap-1) shown in Table 1 . Quantitative RT-PCR was performed as follows: initial denaturation at 95 °C for 10 min, 40 cycles at 95 °C for 15 s and 60 °C for 1 min, and an extension step at 72 °C for 1 min. The expression of studied genes and the housekeeping gene GAPDH was measured by using StepOnePlus real-time PCR (Applied Biosystems, Foster City, CA, USA) by the 2−ΔΔCT equation.
8
qPCR Expression Analysis Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
9
Real-Time PCR Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from cells using TRIazol (Invitrogen, 15 596 018). Reverse transcription was performed with 1 µg of RNA using the Tetro cDNA synthesis kit (Bioline, BIO‐65043). Real‐time PCR was performed using DyNAmo Flash SYBR Green qPCR mix on a StepOnePlus system (Applied Biosciences) and normalized to β‐actin. The primers used for PCR are listed in Table S8 (Supporting Information).
10
Total RNA Isolation and DNase Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by Triazol method (Invitrogen, Carlsbad, CA, USA) followed by quantification using Nano Drop spectrophotometer (ND 1000, Thermo Scientific, USA) as well as by Agarose Gel
Electrophoresis. DNase treatment (Invitrogen, USA) was carried out to remove any contaminating DNA followed by RT-PCR.
Electrophoresis. DNase treatment (Invitrogen, USA) was carried out to remove any contaminating DNA followed by RT-PCR.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!