The largest database of trusted experimental protocols

9 protocols using pcr primers

1

Plasmid Construction for EGFP-2B Study

Check if the same lab product or an alternative is used in the 5 most similar protocols
pmCherry-C1 (Clontech) was a kind gift from Prof. Wenhui Li, Beijing life science Institute, Beijing, China. pmCherry-LC3 was constructed based on pmCherry-C1. pcDNA3.1(+) was kindly provided by Prof. Hong Ling, Department of Microbiology, Harbin Medical University, Harbin, China. Plasmids expressing the of EGFP-2B and EGFP-2B truncated were constructed based on pcDNA3.1(+). Plasmids expressing EGFP-2B mutants were constructed based on pEGFP-2B by site-directed mutagenesis and overlapping polymerase chain reaction (PCR). Sequence analysis of the constructs was performed by Genewiz (Beijing, China). PCR primers were obtained from TaKaRa.
+ Open protocol
+ Expand
2

Quantitative RT-PCR Analysis of Immune Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from each sample using a TRIzol reagent isolation kit (Invitrogen, La Jolla, CA), according to the manufacturer’s instructions. The concentration and purity of RNA were determined spectrophotometrically at 260/280 nm with a nanodrop spectrophotometer (Ocean Optics, Dunedin, FL). One microgram of total RNA was reverse-transcribed into single-stranded complementary DNA with oligo dT primer (TakaRa, Otsu, Japan). PCR primers were designed based on the complementary DNA sequence and synthesized by TaKaRa Biotechnology Company (Chongqing, China). The primers used were as follows: CD47 (forward: GAAGATGGATAAGAGTGATGCTGTC; reverse: ACCTGGGACGAAAAGAATGG), SIRP-α (forward: GGCTCCTGGTGAATGTATCTGC; reverse: GTGTTCTCAGCGGCGGTATT), CD200 (forward: GTCTACCTACAGCCTGGTTTGG; reverse: GCTGGGTAATGTTTATCTTGTCCTT), CD200R (forward: ACTAAGCAAGAATACTGGAGCAATG; reverse: TCAACAACCAAATGAATCCCAC), and IL-4 (forward: GCTACCCTGTTCGGCTTTCCT; reverse: TCCCGTGGTTGTCCTTGTGT). The amplification conditions was as follows: 95 °C for 5 min (1 cycle), followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s. The relative quantification of each product versus the reference gene β-actin was evaluated by the 2−△△ct method.
+ Open protocol
+ Expand
3

Reprogramming Mouse Cells with OSKM

Check if the same lab product or an alternative is used in the 5 most similar protocols
High Glucose Dulbecco's Modified Eagle Medium (H-DMEM) and sucrose-based solution were from Gibco BRL (Rockville, MD, USA). Fetal bovine serum (FBS) was from HyClone Inc. (Logan, UT, USA). Trizol Reagent, PCR primers, and RT-reaction Kit were purchased from TaKaRa Biotechnology (Dalian, Liaoning, China). SYBR Green PCR Master Mix was from Applied Biosystems (Warrington, UK). LipofectamineTM2000 and Zeosin were from Invitrogen (Carlsbad, CA, USA). Basic fibroblastic growth factor (bFGF) was from Gibco (California, USA). C57BL/6 mice were from Jilin University (Jilin, China). Doxycycline (DOX) was from Sigma (San Francisco, USA). Plasmids TetO-FUW-OSKM and FUW-M2rtTA were gifts from Rudolf Jaenisch (Addgene plasmid # 20321 and # 20342).
+ Open protocol
+ Expand
4

Quantifying Gene Expression in Renal Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from renal tissues using Trizol according to the manufacturer's instructions (Takara, Japan). We obtained complementary DNA (cDNA) by reverse transcribing four micrograms of total RNA by using the PrimeScript RT Master Mix (Takara, Japan) as instructed. Real-time PCR amplifications were performed by using qPCR technique of SybrGreen assay on the ABI 7500 system (Applied Biosystems, USA). PCR primers (Takara, Japan) for all analyzed genes are as follows: tumor necrosis factor-α (TNF-α), amplicon size 122 bp, forward, 5′-GTG GAA CTG GCA GAA GAG GC-3′ and reverse, 5′-AGA CAG AAG AGC GTG GTG GC-3′; interleukin-1β (IL-1β), amplicon size 230 bp, forward, 5′-GCC CAT CCT CTG TGA CTC AT-3′ and reverse, 5′-AGG CCA CAG GTA TTT TGT CG-3′; COX-2, amplicon size 121 bp, sense: 5′-CCT GGT CTG ATG ATG TAT GC-3′; antisense: 5′-GTA TGA GTC TGC TGG TTT GG-3′; iNOS, amplicon size 108 bp, forward, 5′-TCC ATG ACT CCC AGC ACA-3′ and reverse, 5′-CCA TCT CCT GCA TTT CTT CC-3′; GAPDH, amplicon size 211 bp, forward, 5′-CAT CAA CGG GAA GCC CAT C-3′ and reverse, 5′-CTC GTG GTT CAC ACC CAT C-3′. PCR conditions were as follows: 94°C for 5 min; 35 cycles at 94°C for 40 s, 58°C for 40 s, and 72°C for 60 s; final elongation at 72°C for 10 min. The relative expression levels were calculated using the 2−ΔΔCt method as reported.
+ Open protocol
+ Expand
5

Quantitative Analysis of CD44v6 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Treatment with various drugs was added to logarithmic growth phase cells. The RNA from cells was extracted using the total RNA extraction kit [centrifugal columnar type; Tiangen Biotech (Beijing) Co., Ltd., Beijing, China]. The RNA was reverse transcribed into complementary DNA (cDNA) according to the manufacturer’s instructions. PCR primers were purchased from Takara Bio, Inc. (Shiga, Japan). The primers used for PCR amplification were: sense, 5′-AGACAGAAATGGCACCAC-3′ and antisense, 5′-AATGGGAGTCTTCTTTGG-3′ for CD44v6 (224-bp product); and sense, 5′-AATCCCATCACCATCTTCC-3′ and antisense, 5′-CATCACGCCACAGTTTCC-3′ for GAPDH (382-bp product). Reaction system of PCR (20 μl altogether) included 2 μl cDNA, 1 μl forward primer (10 μmol/l), 1 μl reverse primer (10 μmol/l), 25μl 2X TransTaq™ HiFi PCR SuperMix II and 21 μl ddH2O. The conditions for PCR were as follows: predenaturation at 94°C for 5 min, 94°C for 30 sec, 50°C for 30 sec and 72°C for 30 sec, for 36 cycles; and elongation at 72°C for 5 min. PCR products were detected by 2% agarose gel. The band density was detected using the Bio-Rad Quantity One software (Bio-Rad, Hercules, CA, USA). The relative band density represented the relative expression levels of CD44v6 and was calculated using the formula:
Relative density of bands=CD44v6band density/GAPDH band density .
+ Open protocol
+ Expand
6

Fluorescent PCR Primer Design and Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR primers were purchased from Takara Biotechnology (Dalian, China).
Their sequences (5′–3′) are as follows: FMTS,
FAM-(iso-dC)-AGCATCCGTCGAGCAGAGTT;22 (link) ACX,
GCGCGG(CTTACC)3CTAACC; FOTS, FAM-(iso-dC)-CAGCATCCGTCACCGAGAGTT.
2× hot-start PCR solution was supplied by Telo-Quant Biotechnique
(Tianjin, China). Dabcyl-iso-dGTP was synthesized as described.24 (link)
+ Open protocol
+ Expand
7

Quantifying XRCC1 Expression in Cervical Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were extracted from frozen tissue samples of patients with cervical cancer using Trizol reagent (Invitrogen, US) and treated by DNase / RNase-free Deionized water (Tiangen, Beijing, China). cycA was used as internal controls in SYBR® Green Realtime PCR Master Mix-Plus kits (Toyobo, Osaka, Japan). The expression level of XRCC1 were amplified with PCR primers (Takara, Shanghai, China) and quantitative using the Quant Studio 6 Flex system (Applied Biosystems, Life Technologies, USA).
+ Open protocol
+ Expand
8

Cisplatin-Induced CD70 Expression in A2780 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A2780‐NF‐kB‐p65‐silenced cells were incubated with 5 μM cisplatin for 0, 1, or 2 h, followed by RNA extraction for real‐time quantitative RT‐PCR. CD70 expression in A2780 cells was determined using RT‐PCR. Total RNA extraction and cDNA synthesis were performed according to the manufacturer's protocol.23 (link), 34 (link)
PCR was performed using TB Green Premix Ex Taq II (#RR820A, Takara Bio, Shiga, Japan) and specific primers. PCR primers were also purchased from Takara Bio. The sequences of the primers used were as follows: human CD70 (180 bp), forward primer 5‐GCCCTATGGGTGCGTCCTGC‐3 and reverse primer 5‐AGCCTGGGGTCCTGCTGAGG‐3; β‐actin (174 bp), 5‐AGCCTCGCCTTTGCCGA‐3 (forward), and 5‐CTGGTGCCTGGGGCG‐3 (reverse).
+ Open protocol
+ Expand
9

Murine Macrophage Polarization by BPA

Check if the same lab product or an alternative is used in the 5 most similar protocols
BPA (purity>99%) was purchased from Tianjin Damao Chemical Reagent Factory (Tianjin, China). IFN-γ and IL-4 were from Peprotech (Rocky Hill, NJ, USA). Lipopolysaccharide (LPS) from Escherichia Coli (serotype: 055: B5) and Dimethylsulfoxide (DMSO) were obtained from Sigma-Aldrich (St. Louis, USA). Dulbecco's modified eagle medium (DMEM) and fetal bovine serum (FBS) were purchased from Hyclone (Logan, USA). Fluorescein isothiocyanate-conjugated anti-mouse CD11c (FITC-CD11c), FITC-conjugated anti-mouse CD206 (FITC-CD206) and phycoerythrin-conjugated anti-mouse F4/80 (PE-F4/80) were purchased from Biolegend (San Diego, USA). ELISA Kits for quantitative measurement of iNOS, TNF-α, IL-6, MCP-1, Arg-1, IL-10 and TGF-β were purchased from Calvin Biological Technology co. (Suzhou, China).
RNeasy Mini Kit was purchased from Qiagen (Austin, USA). Transcription First Strand cDNA Synthesis kit and Light Cycler 480 SYBR Green I Master were purchased from Roche (Basel, Switzerland). PCR-Primers were obtained from Takara BIO (Dalian, China). Anti-mouse IRF4, anti-mouse IRF5, and β-actin antibody were from Abcam (Cambridge, USA). BPA was dissolved in DMSO (the final concentration of DMSO in the medium was no more than 0.1%).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!