Pcr primers
PCR primers are short DNA sequences that serve as the starting point for the Polymerase Chain Reaction (PCR) process. They are designed to target and amplify specific regions of DNA, enabling the selective replication of genetic material.
Lab products found in correlation
9 protocols using pcr primers
Plasmid Construction for EGFP-2B Study
Quantitative RT-PCR Analysis of Immune Markers
Reprogramming Mouse Cells with OSKM
Quantifying Gene Expression in Renal Tissues
Quantitative Analysis of CD44v6 Expression
.
Fluorescent PCR Primer Design and Synthesis
Their sequences (5′–3′) are as follows: FMTS,
FAM-(iso-dC)-AGCATCCGTCGAGCAGAGTT;22 (link) ACX,
GCGCGG(CTTACC)3CTAACC; FOTS, FAM-(iso-dC)-CAGCATCCGTCACCGAGAGTT.
2× hot-start PCR solution was supplied by Telo-Quant Biotechnique
(Tianjin, China). Dabcyl-iso-dGTP was synthesized as described.24 (link)
Quantifying XRCC1 Expression in Cervical Cancer
Cisplatin-Induced CD70 Expression in A2780 Cells
PCR was performed using TB Green Premix Ex Taq II (#RR820A, Takara Bio, Shiga, Japan) and specific primers. PCR primers were also purchased from Takara Bio. The sequences of the primers used were as follows: human CD70 (180 bp), forward primer 5‐GCCCTATGGGTGCGTCCTGC‐3 and reverse primer 5‐AGCCTGGGGTCCTGCTGAGG‐3; β‐actin (174 bp), 5‐AGCCTCGCCTTTGCCGA‐3 (forward), and 5‐CTGGTGCCTGGGGCG‐3 (reverse).
Murine Macrophage Polarization by BPA
RNeasy Mini Kit was purchased from Qiagen (Austin, USA). Transcription First Strand cDNA Synthesis kit and Light Cycler 480 SYBR Green I Master were purchased from Roche (Basel, Switzerland). PCR-Primers were obtained from Takara BIO (Dalian, China). Anti-mouse IRF4, anti-mouse IRF5, and β-actin antibody were from Abcam (Cambridge, USA). BPA was dissolved in DMSO (the final concentration of DMSO in the medium was no more than 0.1%).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!