Riboscript reverse transcription kit

RT-qPCR was performed on the RNA obtained from blood samples of the remaining 27 patients with COPD and 27 healthy controls, and the expression of related circRNAs was also verified in 15 patients with non-very severe COPD. The qRT-PCR method was as follows: according to the kit instructions, RNA was reverse-transcribed into cDNA using the riboSCRIPT Reverse Transcription Kit (C11027, RiboBio, Guangzhou, China), and qRT-PCR was performed using iQTM SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA) with an LC480 fluorescent quantitative PCR instrument (Roche, Basel, Switzerland). The reaction conditions were as follows: 95 ℃ for 10 min, followed by 45 cycles of 95 ℃ for 10 s, 60 ℃ for 25 s, and 70 ℃ for 25 s. λ polyA (No.3789, TakaRa, Tokyo, Japan) was used as the external reference, and three complex wells were set up for each circRNA. The primer sequences used for circRNA analysis are shown in Table 1. The qRT-PCR results were analyzed by relative quantification using the 2^−ΔΔCt method.
Table 1

Primer sequences used for RT-qPCR

CircRNA	Forward primer (5′–3′)	Reverse primer (5′–3′)
hsa_circ_0008882	GGAATACCTTTCCTCACAGGAC	CTAGGCTGCCAATGGTGAG
hsa_circ_0089763	TTTAGTTGGGGCATTTATGTGA	CCTCAACCCAAAAAGGCATA
hsa_circ_0062683	GTCTCCCTGTCCAAGGCTCT	CCTTGGGCACTCTCATCTCT
hsa_circ_0077607	CTGCCCTTCACTTTGACCAG	GCTCCCAACTAGAAAGTATCTCTTCA

To analyze the effect of the two polymorphisms on the gene expression of miR-143 and miR-145, fifty-two EOC tissues were collected from the abovementioned case subjects at the time of the primary cytoreductive surgery. All EOC tissue samples were stored in RNAlater solution immediately after surgical removal. Total RNA was extracted using TRIzol reagent (Generay Biotech Co., LTD, China). The quality and concentration of the extracted RNA was testeded with a UV spectrophotometer (NanoDrop 2000; Thermo Scientific, USA). The miRNAs were reverse transcribed to synthesize the first-strand cDNA with the riboSCRIPT™ Reverse Transcription Kit (RiboBio Co., Ltd., Guangzhou, China). qRT-PCR was conducted using miRNA Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd, Nanjing, China). The relative expression levels of miR-143 and miR-145 were obtained by the 2^-ΔΔCt method, and each reaction was performed in triplicate.

Exosome-RNAs were isolated from exosomes with Trizol (Invitrogen, Carlsbad, CA, USA) according to the standard procedures and cel-miR-39 (RiboBio, China) was added to normalize the technical variation between samples. Tissue and cell RNAs were extracted with RNA-Quick Purification Kit for small RNA (ES Science, China) according to the protocols obtained from the manufacturers, and U6 (RiboBio, China) was used as the internal reference for miRNA. RNA concentrations were verified on the NanoDrop Spectrophotometer (Thermo Scientific, USA). Isolated RNA was reversely transcribed using miRNA primers (Bulge-LoopTM miRNA RT primer) and the riboSCRIPT Reverse Transcription Kit (RiboBio, China). qRT-PCR was performed on a Roche LightCycler 480°C System (Roche, Switzerland) using a TB Green Premix Ex Taq II Kit (Takara, Japan). Amplification was performed at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 20 s. All procedures were performed according to the protocols obtained from the manufacturers. Fold change in RNA species was calculated using formula 2^(−ΔΔCt). ΔΔCt = (Ct target miRNA–Ct control). The sequences were as follows:
miR-126a-3p 5′-UCGUACCGUGAGUAAUAAUGCG-3′
let-7c-5p 5′-UGAGGUAGUAGGUUGUAUGGUU-3′
let-7f-5p 5′-UGAGGUAGUAGAUUGUAUAGUU-3′
miR-203a-3p 5′-GUGAAAUGUUUAGGACCACUAG-3′
miR-144-3p 5′-UACAGUAUAGAUGAUGUACU-3′
miR-98-5p 5′-UGAGGUAGUAAGUUGUAUUGUU-3′.

Total RNA was extracted using TRIzol reagent (Invitrogen, US) according to the standard procedures 23 (link) and concentration was measured with a microplate reader. cDNA was synthesized with riboSCRIPT Reverse Transcription Kit (RIBOBIO, China) according to the manufacturer's protocol. Quantitative real-time PCR was performed using QuantiNova SYBR Green PCR Kit (QIAGEN, Germany) and reaction samples were run on a QuantStudio5 qPCR system (ThermoFisher, US). The primers of qRT-PCR were synthesized by RIBOBIO (China). The Ct values for each gene were normalized to those of GAPDH, and the 2^-ΔΔCt method was used for quantitative analysis of gene expression.

Total RNA was extracted from the cells/liver tissues using Eastep™ Total RNA Extraction Kit (Promega, Madison, United States) and miRNAs were extracted from the cells/liver tissues using the EasyPure miRNA Kit (TransGen, Beijing, China) following the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen) to detect mRNA. cDNA was generated using a Ribo SCRIPT™ Reverse Transcription kit (RiboBio) to detect miRNA. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using PerfectStart™ Green qPCR SuperMix (TransGen). β-actin was used as an mRNA control. U6 was used as a reference miRNA control. The primers for U6/miR-654-5p were obtained from RiboBio Co., Ltd. All other qPCR primers used are listed in Table 1 qPCR was performed using the Agilent Mx3005P Real-Time PCR System (Applied Biosystems, Foster City, CA).

Complementary DNA (cDNA) for mRNA was synthesized using the PrimeScript RT Master Mix kit. Reverse transcription for circRNA was performed using the riboSCRIPT Reverse Transcription Kit (Ribobio, Guangzhou, China). For miRNAs, reverse transcription was conducted using the miRNA First Strand cDNA Synthesis (Tailing Reaction) kit (Sangon Biotech, Shanghai, China). qRT-PCR was conducted using SYBR Premix Ex Taq I. β-Actin was utilized as the internal control for mRNA analysis, whereas U6 served as the internal control for miRNA analysis.