The total RNA from the skeletal muscle (SOL) was extracted using TRIzol reagent (Roche, Indianapolis, IN, USA). cDNA was synthesized from 2 μg of the total RNA using a HyperScriptTM RT master mix kit (GeneAll Biotechnology, Seoul, Korea). Real-time PCR for various genes was performed using Rotor-gene 300 PCR (Corbett Research, Mortlake, NSW, Australia) and Rotor-GeneTM SYBR Green Kit (QIAGEN, Hilden, Germany). The data were then analyzed using the Rotor-gene 6000 series System Software program (Corbett Research), and the values were normalized to those of Gapdh. Table 1 lists the various primers used for real-time PCR analysis.
Hyperscript rt master mix kit
Manufactured by GeneAll
Sourced in United States
The HyperScriptTM RT master mix kit is a laboratory instrument designed for the reverse transcription of RNA samples. It contains all the necessary components for the efficient conversion of RNA into complementary DNA (cDNA) in a single reaction mixture. The kit provides a reliable and streamlined solution for the initial step in various downstream molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (3 mentions)
Rotor gene sybr green kit, by Qiagen (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Rotor gene 6000 series system software program, by Qiagen (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Roche (1 mentions)
Riboex kit, by GeneAll (1 mentions)
Ginsenoside re, by Merck Group (1 mentions)
G csf, by R&D Systems (1 mentions)
Platycodin d, by Merck Group (1 mentions)
Nf κb p65, by Cell Signaling Technology (1 mentions)
β actin, by Cell Signaling Technology (1 mentions)
P erk, by Cell Signaling Technology (1 mentions)
Quercetin, by Merck Group (1 mentions)
Tannic acid, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Welgene (1 mentions)
Dulbecco s modified eagle s medium dmem, by Welgene (1 mentions)
Penicillin streptomycin, by Welgene (1 mentions)
Gm csf, by R&D Systems (1 mentions)
Mcp 1, by R&D Systems (1 mentions)
8 protocols using hyperscript rt master mix kit
1
Skeletal Muscle RNA Extraction and Gene Expression Analysis
2
XBP1 Splicing Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was performed from the Lys treated C2C12 myotubes and 3T3-L1 adipocytes using the protocol supplied with the RiboExTM kit (GeneAll®, Korea) according to the manufacturer’s instructions. Total RNA (2 μg) was reverse transcribed (RT) with HyperscriptTM RT Mastermix Kit (GeneAll, Korea). The final PCR products were electrophoresed on 1–1.5% agarose gels containing EB along with DNA Ladder (SMOBIO DM2300 ladder). The expression and splicing of XBP1 mRNA was determined using RT-PCR. The cDNA sample was amplified using Taq DNA Polymerase Master Mix, Red (Amplicon) in the presence of the XBP1 mRNA primer pair (forward primer: TTACGAGAGAAAACTCATGGCC and reverse primer: GGGTCCAAGTTGTCCAGAATGC). Briefly, the reaction conditions consisted of 2 μl of cDNA and 0.2 μM primers in a final volume of 20 μl of master mix. Each cycle consisted of denaturation at 95°C for 15 s, annealing at 60°C for 5 s and extension at 72°C for 10 s, respectively. Amplified fragments covering flanking exon fragments consist sXBP1 (spliced XBP1) and uXBP1 (unspliced XBP1) were separated on 1–1.5% agarose gels containing EB along with DNA Ladder (SMOBIO DM2300 ladder). The measurements were performed by three independent experiments in triplicate. The intensity of the PCR product bands was assessed in the Image J software (NIH approved) and semiquantitative data were obtained.
3
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the tumor tissue was extracted with Trizol (Invitrogen Life
Technologies, Carlsbad, CA, USA) according to the manufacturer’s instruction.
The content and the purity of the total RNA were determined using a micro-volume
spectrophotometer (BioSpec-nano, Shimadzu, Kyoto, Japan). Complementary DNA was
synthesized from 2 μg of total RNA using HyperScriptTM RT master mix
kit (GeneAll Biotechnology, Seoul, Korea). Real-time PCR of cDNA was conducted
using a Rotor-gene 3000 PCR (Corbett Research, Mortlake, Australia) and a
Rotor-GeneTM SYBR Green kit (Qiagen, Valencia, CA, USA) according
to the manufacturer’s instructions. The primer sequences used in this study are
shown inTable 1 . The
results were analyzed with Rotor-Gene 6000 Series System Software program,
version 6 (Corbett Research) and normalized to those of glyceraldehyde
3-phosphate dehydrogenase (GAPDH).
Technologies, Carlsbad, CA, USA) according to the manufacturer’s instruction.
The content and the purity of the total RNA were determined using a micro-volume
spectrophotometer (BioSpec-nano, Shimadzu, Kyoto, Japan). Complementary DNA was
synthesized from 2 μg of total RNA using HyperScriptTM RT master mix
kit (GeneAll Biotechnology, Seoul, Korea). Real-time PCR of cDNA was conducted
using a Rotor-gene 3000 PCR (Corbett Research, Mortlake, Australia) and a
Rotor-GeneTM SYBR Green kit (Qiagen, Valencia, CA, USA) according
to the manufacturer’s instructions. The primer sequences used in this study are
shown in
results were analyzed with Rotor-Gene 6000 Series System Software program,
version 6 (Corbett Research) and normalized to those of glyceraldehyde
3-phosphate dehydrogenase (GAPDH).
4
Anti-inflammatory Cytokine Pathway Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reagents and materials used in this study were purchased from the indicated suppliers: Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), and penicillin/streptomycin from Welgene Inc. (Gyeongsan, Korea); 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), Folin-Ciocalteu’s phenol reagent, ginsenoside-Re, platycodin D, quercetin, and tannic acid from Sigma-Aldrich Co. (St. Louis, MO, USA); Trizol from Invitrogen Life Technologies (Carlsbad, CA, USA); HyperScriptTM RT master mix kit from GeneAll Biotechnology (Seoul, Korea); Rotor-GeneTM SYBR Green kit from Qiagen (Valencia, CA, USA); proteome profilerTM mouse cytokine array kit and enzyme-linked immunosorbent assay (ELISA) kits for interleukin (IL)-1β, IL-6, tumor necrosis factor (TNF)-α, C-X-C motif chemokine ligand (CXCL)10, granulocyte-colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), and monocyte chemoattractant protein (MCP)-1 from R&D Systems (Minneapolis, MN, USA); antibodies against nuclear factor (NF)-κB p65, p-p65, extracellular signal-regulated kinase (ERK), p-ERK, c-Jun N-terminal kinase (JNK), p-JNK, and β-actin from Cell Signaling Technology (Beverly, MA, USA).
5
Liver Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by using a TRIzol Reagent (Thermo Fisher Scientific) on liver tissue collected at the end of the experiment. Next, cDNA was obtained from total RNA (2 μg) by using a HyperScriptTM RT master mix kit (GeneAll biotechnology); the mRNA levels of COX-2, iNOS, TNF-α, IL-6, MCP-1, and CYP2E1 genes were investigated by performing real-time PCR. The information on the primers used is shown in Table 1 . For gene quantitative analysis, a Rotor-Gene 6,000 series system software 1.7 program (Corbett Research) was used.
6
Osteogenic Differentiation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The materials used in this study were purchased from the indicated suppliers: α-minimal essential medium (α-MEM), fetal bovine serum (FBS), and penicillin/streptomycin from Thermo Fisher Scientific Inc. (Waltham, MA, USA); 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), ascorbic acid, β-glycerophosphate and 17-estradiol (E2) from Sigma-Aldrich Co. (St. Louis, MO, USA); TRACP & ALP assay and osteocalcin enzyme-linked immunosorbent assay (ELISA) kits from Takara Bio Inc. (Kusatsu, Japan); Sirius Red collagen detection kit from Chondrex Inc. (Redmond, WA, USA); Osteogenesis assay kit from Millipore (Burlington, MA, USA); Trizol from Invitrogen Life Technologies (Carlsbad, CA, USA); HyperScript™ RT master mix kit from GeneAll Biotechnology (Seoul, Korea); Rotor-Gene™ SYBR Green kit from Qiagen (Valencia, CA, USA).
7
Quantifying mRNA Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 4 days of cell differentiation, total RNA was isolated by using an RNeasy® Plus Mini kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. First-strand reverse transcription was performed with 2 μg total RNA using a Hyperscript™ RT master mix kit (GeneAll Biotechnology, Seoul, Korea). The levels of transcripts were determined by performing qRT-PCR on a Rotor-Gene 3000 instrument (Corbett Research, Mortlake, Australia) and using a Rotor-Gene™ SYBR Green Kit (Qiagen) as a double-stranded DNA-specific dye, according to the manufacturer's instructions. The primers used in the present study were ordered from and synthesized by Bioneer Co. (Daejeon, Korea); their sequences are listed in Table 1 . The qRT-PCR consisted of 41 cycles, comprising 1 cycle of 3 min at 94°C and 40 cycles of 10 s at 95°C, 15 s at 60°C, and 20 s at 72°C. The amount of mRNA expression was normalized with the housekeeping gene Gapdh to determine the relative expression ratios for each mRNA gene expression relative to the control group. For statistical analysis purposes, all experiments included a minimum of three independent PCR reactions.
8
Quantitative RT-PCR Analysis of Synovial RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the synovia of the knee joints using TRIzol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. A Micro-volume UV-Vis Spectrophotometer (BioSpec-nano, Shimadzu, Kyoto, Japan) was used to determine the content and purity of the total RNA. Total RNA (2 µg) was reverse transcribed to complementary single stranded DNA using the HyperScript RT master mix kit (GeneAll Biotechnology, Seoul, Korea). Real-time PCR was performed with Rotor-Gene SYBR Green PCR Kit (Qiagen, Valencia, CA, USA) and Rotor-Gene 3000 instrument (Corbett Research, Mortlake, Australia) according to the manufacturer's instructions. Table 1 shows the nucleic acid sequences of the primers used in this study. The results were analyzed using the Rotor-Gene 6000 Series software program (Corbett Research, version 6). The relative expression levels of target genes were normalized to those of glyceraldehyde 3-phosphate dehydrogenase (Gapdh).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!